EMAIL THIS PAGE TO A FRIEND

H1FNT

H1 histone family, member N, testis-specific

44 Gene Product Result for
Synonyms: H1T2
UniProtKB ID: Q75WM6, Q147U8, Q5GKZ5, Q7Z694
Gene ID:
Mouse(70069) H1 histone family, member N, testis-specific
Rat(500928) H1 histone family, member N, testis-specific
cow(617351) H1 histone family, member N, testis-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181788 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136491 MISSION® esiRNA esiRNA human H1FNT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181788 Rosetta Predictions human pricing
NM_001024356 Rosetta Predictions rat pricing
NM_027304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090669 predicted 829
2 SASI_Hs01_00090670 predicted 421
3 SASI_Hs01_00090671 predicted 557
4 SASI_Hs01_00090672 predicted 469
5 SASI_Hs01_00090673 predicted 415
6 SASI_Hs01_00090674 predicted 569
7 SASI_Hs01_00090675 predicted 1068
8 SASI_Hs01_00090676 predicted 531
9 SASI_Hs01_00090677 predicted 659
10 SASI_Hs01_00090678 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121626 predicted 675
2 SASI_Rn01_00121627 predicted 537
3 SASI_Rn01_00121628 predicted 1072
4 SASI_Rn01_00121629 predicted 576
5 SASI_Rn02_00202585 predicted 551
6 SASI_Rn01_00121630 predicted 740
7 SASI_Rn01_00121631 predicted 609
8 SASI_Rn01_00121632 predicted 212
9 SASI_Rn01_00121634 predicted 322
10 SASI_Rn01_00121633 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029840 predicted 562
2 SASI_Mm01_00029841 predicted 746
3 SASI_Mm01_00029842 predicted 633
4 SASI_Mm01_00029843 predicted 579
5 SASI_Mm01_00029844 predicted 312
6 SASI_Mm02_00331915 predicted 730
7 SASI_Mm01_00029845 predicted 198
8 SASI_Mm01_00029847 predicted 486
9 SASI_Mm01_00029848 predicted 660
10 SASI_Mm01_00029849 predicted 1034
11 SASI_Mm01_00029846 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027304
H1FNT MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member N, testis-specific
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-990s1c1
Sequence:CCGGACAACAGAGTACGGCCTACAACTCGAGTTGTAGGCCGTACTCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-52s1c1
Sequence:CCGGCGCAGAACTTACGATCCAGATCTCGAGATCTGGATCGTAAGTTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-711s1c1
Sequence:CCGGCCAGGTCAAAGGCTAGGTCAACTCGAGTTGACCTAGCCTTTGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-336s1c1
Sequence:CCGGAGATTTCAAAGCCGAGGGAAACTCGAGTTTCCCTCGGCTTTGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-627s1c1
Sequence:CCGGCCCAGTCAAGTGCCAGATCAACTCGAGTTGATCTGGCACTTGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-1155s21c1
Sequence:CCGGGACAACGCTCCCAGCATACAACTCGAGTTGTATGCTGGGAGCGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-607s21c1
Sequence:CCGGCCACTTCAAGGGCCACATCAACTCGAGTTGATGTGGCCCTTGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-691s21c1
Sequence:CCGGCCAAGTCAAGCGCCAAGTCAACTCGAGTTGACTTGGCGCTTGACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027304
H1FNT MISSION shRNA shRNA Plasmid DNA
H1 histone family, member N, testis-specific
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-990s1c1
Sequence:CCGGACAACAGAGTACGGCCTACAACTCGAGTTGTAGGCCGTACTCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-52s1c1
Sequence:CCGGCGCAGAACTTACGATCCAGATCTCGAGATCTGGATCGTAAGTTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-711s1c1
Sequence:CCGGCCAGGTCAAAGGCTAGGTCAACTCGAGTTGACCTAGCCTTTGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-336s1c1
Sequence:CCGGAGATTTCAAAGCCGAGGGAAACTCGAGTTTCCCTCGGCTTTGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-627s1c1
Sequence:CCGGCCCAGTCAAGTGCCAGATCAACTCGAGTTGATCTGGCACTTGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-1155s21c1
Sequence:CCGGGACAACGCTCCCAGCATACAACTCGAGTTGTATGCTGGGAGCGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-607s21c1
Sequence:CCGGCCACTTCAAGGGCCACATCAACTCGAGTTGATGTGGCCCTTGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-691s21c1
Sequence:CCGGCCAAGTCAAGCGCCAAGTCAACTCGAGTTGACTTGGCGCTTGACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027304
H1FNT MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member N, testis-specific
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-990s1c1
Sequence:CCGGACAACAGAGTACGGCCTACAACTCGAGTTGTAGGCCGTACTCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-52s1c1
Sequence:CCGGCGCAGAACTTACGATCCAGATCTCGAGATCTGGATCGTAAGTTCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-711s1c1
Sequence:CCGGCCAGGTCAAAGGCTAGGTCAACTCGAGTTGACCTAGCCTTTGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-336s1c1
Sequence:CCGGAGATTTCAAAGCCGAGGGAAACTCGAGTTTCCCTCGGCTTTGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027304.1-627s1c1
Sequence:CCGGCCCAGTCAAGTGCCAGATCAACTCGAGTTGATCTGGCACTTGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-1155s21c1
Sequence:CCGGGACAACGCTCCCAGCATACAACTCGAGTTGTATGCTGGGAGCGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-607s21c1
Sequence:CCGGCCACTTCAAGGGCCACATCAACTCGAGTTGATGTGGCCCTTGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027304.2-691s21c1
Sequence:CCGGCCAAGTCAAGCGCCAAGTCAACTCGAGTTGACTTGGCGCTTGACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181788
H1FNT MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member N, testis-specific
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-998s1c1
Sequence:CCGGCAGGGAAGGACAAGAGGCGAACTCGAGTTCGCCTCTTGTCCTTCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-816s1c1
Sequence:CCGGCAGAGAAGTGTGGAGACGGAACTCGAGTTCCGTCTCCACACTTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181788.1-1128s1c1
Sequence:CCGGTCCACTAAAGACTTCCACAAACTCGAGTTTGTGGAAGTCTTTAGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-483s1c1
Sequence:CCGGGCTCAGAGTGTCCCAGTTGGTCTCGAGACCAACTGGGACACTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-421s1c1
Sequence:CCGGGCCACTCAGCTGCCAGCGGAACTCGAGTTCCGCTGGCAGCTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181788.1-1064s21c1
Sequence:CCGGAGCGGACCATCCAGTAGCCAACTCGAGTTGGCTACTGGATGGTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181788.1-684s21c1
Sequence:CCGGGGTTCCCAAGCCCAGGAGAAACTCGAGTTTCTCCTGGGCTTGGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181788
H1FNT MISSION shRNA shRNA Plasmid DNA
H1 histone family, member N, testis-specific
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-998s1c1
Sequence:CCGGCAGGGAAGGACAAGAGGCGAACTCGAGTTCGCCTCTTGTCCTTCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-816s1c1
Sequence:CCGGCAGAGAAGTGTGGAGACGGAACTCGAGTTCCGTCTCCACACTTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181788.1-1128s1c1
Sequence:CCGGTCCACTAAAGACTTCCACAAACTCGAGTTTGTGGAAGTCTTTAGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-483s1c1
Sequence:CCGGGCTCAGAGTGTCCCAGTTGGTCTCGAGACCAACTGGGACACTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-421s1c1
Sequence:CCGGGCCACTCAGCTGCCAGCGGAACTCGAGTTCCGCTGGCAGCTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181788.1-1064s21c1
Sequence:CCGGAGCGGACCATCCAGTAGCCAACTCGAGTTGGCTACTGGATGGTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181788.1-684s21c1
Sequence:CCGGGGTTCCCAAGCCCAGGAGAAACTCGAGTTTCTCCTGGGCTTGGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181788
H1FNT MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member N, testis-specific
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-998s1c1
Sequence:CCGGCAGGGAAGGACAAGAGGCGAACTCGAGTTCGCCTCTTGTCCTTCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-816s1c1
Sequence:CCGGCAGAGAAGTGTGGAGACGGAACTCGAGTTCCGTCTCCACACTTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181788.1-1128s1c1
Sequence:CCGGTCCACTAAAGACTTCCACAAACTCGAGTTTGTGGAAGTCTTTAGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-483s1c1
Sequence:CCGGGCTCAGAGTGTCCCAGTTGGTCTCGAGACCAACTGGGACACTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181788.1-421s1c1
Sequence:CCGGGCCACTCAGCTGCCAGCGGAACTCGAGTTCCGCTGGCAGCTGAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181788.1-1064s21c1
Sequence:CCGGAGCGGACCATCCAGTAGCCAACTCGAGTTGGCTACTGGATGGTCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181788.1-684s21c1
Sequence:CCGGGGTTCCCAAGCCCAGGAGAAACTCGAGTTTCTCCTGGGCTTGGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)