EMAIL THIS PAGE TO A FRIEND

H1FOO

H1 histone family, member O, oocyte-specific

45 Gene Product Result for
Synonyms: osH1
UniProtKB ID: Q8IZA3, Q86WT7
Gene ID:
Human(132243) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. The protein encoded is a member of the histone H1 family. This gene contains introns, unlike most histone genes. The protein encoded is a member of the histone H1 family. The related mouse gene is expressed only in oocytes. [provided by RefSeq, Jul 2008]
Mouse(171506) H1 histone family, member O, oocyte-specific
Rat(502875) H1 histone family, member O, oocyte-specific
chicken(771929) H1 histone family, member O, oocyte-specific
dog(609826) H1 histone family, member O, oocyte-specific
cow(527400) H1 histone family, member O, oocyte-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153833 Rosetta Predictions human pricing
NM_001109351 Rosetta Predictions rat pricing
NM_138311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159493 predicted 258
2 SASI_Hs01_00159494 predicted 498
3 SASI_Hs01_00159495 predicted 367
4 SASI_Hs01_00159496 predicted 583
5 SASI_Hs01_00159497 predicted 504
6 SASI_Hs01_00159498 predicted 627
7 SASI_Hs01_00159499 predicted 484
8 SASI_Hs01_00159500 predicted 484
9 SASI_Hs01_00159501 predicted 609
10 SASI_Hs01_00159502 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247574 predicted 246
2 SASI_Rn02_00247575 predicted 918
3 SASI_Rn02_00247576 predicted 530
4 SASI_Rn02_00247577 predicted 834
5 SASI_Rn02_00247578 predicted 748
6 SASI_Rn02_00247579 predicted 539
7 SASI_Rn02_00247580 predicted 523
8 SASI_Rn02_00247581 predicted 483
9 SASI_Rn02_00247582 predicted 822
10 SASI_Rn02_00247583 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148945 predicted 229
2 SASI_Mm01_00148946 predicted 569
3 SASI_Mm01_00148947 predicted 295
4 SASI_Mm01_00148948 predicted 552
5 SASI_Mm01_00148950 predicted 710
6 SASI_Mm01_00148951 predicted 394
7 SASI_Mm01_00148952 predicted 582
8 SASI_Mm01_00148953 predicted 779
9 SASI_Mm01_00148954 predicted 883
10 SASI_Mm02_00339612 predicted 581
11 SASI_Mm01_00148949 predicted 542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153833
H1FOO MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member O, oocyte-specific
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153833.1-247s21c1
Sequence:CCGGTCCTGCACAAGTACCCAACAGCTCGAGCTGTTGGGTACTTGTGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153833.1-224s21c1
Sequence:CCGGGGTGGCAGCTATCAAGCTCTACTCGAGTAGAGCTTGATAGCTGCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-67s1c1
Sequence:CCGGCCAGGTCTCCTGAATCTGAAACTCGAGTTTCAGATTCAGGAGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-811s1c1
Sequence:CCGGAGGTCAAGAATGGTGCTGCTTCTCGAGAAGCAGCACCATTCTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-476s1c1
Sequence:CCGGCAAGAAACCAAGTGAGGCCAACTCGAGTTGGCCTCACTTGGTTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-374s1c1
Sequence:CCGGCAGCTTCAAATTAGTTCCCAACTCGAGTTGGGAACTAATTTGAAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-776s1c1
Sequence:CCGGAGCTGAGAGTAAGAGTTCAAACTCGAGTTTGAACTCTTACTCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153833
H1FOO MISSION shRNA shRNA Plasmid DNA
H1 histone family, member O, oocyte-specific
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153833.1-247s21c1
Sequence:CCGGTCCTGCACAAGTACCCAACAGCTCGAGCTGTTGGGTACTTGTGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153833.1-224s21c1
Sequence:CCGGGGTGGCAGCTATCAAGCTCTACTCGAGTAGAGCTTGATAGCTGCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-67s1c1
Sequence:CCGGCCAGGTCTCCTGAATCTGAAACTCGAGTTTCAGATTCAGGAGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-811s1c1
Sequence:CCGGAGGTCAAGAATGGTGCTGCTTCTCGAGAAGCAGCACCATTCTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-476s1c1
Sequence:CCGGCAAGAAACCAAGTGAGGCCAACTCGAGTTGGCCTCACTTGGTTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-374s1c1
Sequence:CCGGCAGCTTCAAATTAGTTCCCAACTCGAGTTGGGAACTAATTTGAAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-776s1c1
Sequence:CCGGAGCTGAGAGTAAGAGTTCAAACTCGAGTTTGAACTCTTACTCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153833
H1FOO MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member O, oocyte-specific
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153833.1-247s21c1
Sequence:CCGGTCCTGCACAAGTACCCAACAGCTCGAGCTGTTGGGTACTTGTGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153833.1-224s21c1
Sequence:CCGGGGTGGCAGCTATCAAGCTCTACTCGAGTAGAGCTTGATAGCTGCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-67s1c1
Sequence:CCGGCCAGGTCTCCTGAATCTGAAACTCGAGTTTCAGATTCAGGAGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-811s1c1
Sequence:CCGGAGGTCAAGAATGGTGCTGCTTCTCGAGAAGCAGCACCATTCTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-476s1c1
Sequence:CCGGCAAGAAACCAAGTGAGGCCAACTCGAGTTGGCCTCACTTGGTTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-374s1c1
Sequence:CCGGCAGCTTCAAATTAGTTCCCAACTCGAGTTGGGAACTAATTTGAAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153833.1-776s1c1
Sequence:CCGGAGCTGAGAGTAAGAGTTCAAACTCGAGTTTGAACTCTTACTCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138311
H1FOO MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member O, oocyte-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-394s1c1
Sequence:CCGGGCAGCTTCAAACTAGTTCCAACTCGAGTTGGAACTAGTTTGAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-607s1c1
Sequence:CCGGCGAAACCGAAAGAGGTCAGAACTCGAGTTCTGACCTCTTTCGGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-296s1c1
Sequence:CCGGCACCCGTTTCAAGTACCTGTTCTCGAGAACAGGTACTTGAAACGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-898s1c1
Sequence:CCGGACAAAGTACAACCCATACCTACTCGAGTAGGTATGGGTTGTACTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-488s1c1
Sequence:CCGGGAAATCTGGATTGCTGAAGAACTCGAGTTCTTCAGCAATCCAGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138311
H1FOO MISSION shRNA shRNA Plasmid DNA
H1 histone family, member O, oocyte-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-394s1c1
Sequence:CCGGGCAGCTTCAAACTAGTTCCAACTCGAGTTGGAACTAGTTTGAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-607s1c1
Sequence:CCGGCGAAACCGAAAGAGGTCAGAACTCGAGTTCTGACCTCTTTCGGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-296s1c1
Sequence:CCGGCACCCGTTTCAAGTACCTGTTCTCGAGAACAGGTACTTGAAACGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-898s1c1
Sequence:CCGGACAAAGTACAACCCATACCTACTCGAGTAGGTATGGGTTGTACTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-488s1c1
Sequence:CCGGGAAATCTGGATTGCTGAAGAACTCGAGTTCTTCAGCAATCCAGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138311
H1FOO MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member O, oocyte-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-394s1c1
Sequence:CCGGGCAGCTTCAAACTAGTTCCAACTCGAGTTGGAACTAGTTTGAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-607s1c1
Sequence:CCGGCGAAACCGAAAGAGGTCAGAACTCGAGTTCTGACCTCTTTCGGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-296s1c1
Sequence:CCGGCACCCGTTTCAAGTACCTGTTCTCGAGAACAGGTACTTGAAACGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-898s1c1
Sequence:CCGGACAAAGTACAACCCATACCTACTCGAGTAGGTATGGGTTGTACTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138311.1-488s1c1
Sequence:CCGGGAAATCTGGATTGCTGAAGAACTCGAGTTCTTCAGCAATCCAGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)