EMAIL THIS PAGE TO A FRIEND

H1FX-AS1

H1FX antisense RNA 1

33 Gene Product Result for
Synonyms: C3orf47
Species: Human H1FX-AS1(339942)
UniProtKB ID: Q4G0G2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_379214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040787 Rosetta Predictions human pricing
XR_040788 Rosetta Predictions human pricing
XR_040789 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521931 predicted 609
2 SASI_Hs02_00521932 predicted 717
3 SASI_Hs02_00521933 predicted 617
4 SASI_Hs02_00521934 predicted 696
5 SASI_Hs02_00521935 predicted 601
6 SASI_Hs02_00521936 predicted 671
7 SASI_Hs02_00521937 predicted 693
8 SASI_Hs02_00521938 predicted 730
9 SASI_Hs02_00521939 predicted 593
10 SASI_Hs02_00521940 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521941 predicted 605
2 SASI_Hs02_00521942 predicted 724
3 SASI_Hs02_00521943 predicted 614
4 SASI_Hs02_00521944 predicted 688
5 SASI_Hs02_00521945 predicted 603
6 SASI_Hs02_00521946 predicted 668
7 SASI_Hs02_00521947 predicted 694
8 SASI_Hs02_00521948 predicted 723
9 SASI_Hs02_00521949 predicted 592
10 SASI_Hs02_00521950 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521951 predicted 611
2 SASI_Hs02_00521952 predicted 719
3 SASI_Hs02_00521953 predicted 619
4 SASI_Hs02_00521954 predicted 692
5 SASI_Hs02_00521955 predicted 600
6 SASI_Hs02_00521956 predicted 666
7 SASI_Hs02_00521957 predicted 697
8 SASI_Hs02_00521958 predicted 726
9 SASI_Hs02_00521959 predicted 596
10 SASI_Hs02_00521960 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379214
H1FX-AS1 MISSION shRNA Bacterial Glycerol Stock
H1FX antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2763s1c1
Sequence:CCGGCATCCCATTCTATCTGAACAACTCGAGTTGTTCAGATAGAATGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1387s1c1
Sequence:CCGGGCAAAGCAATGGCTTCTTCAACTCGAGTTGAAGAAGCCATTGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2990s1c1
Sequence:CCGGGCGTTGTTAAAGTTTGTTGATCTCGAGATCAACAAACTTTAACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2956s1c1
Sequence:CCGGGACTCCAAGAAAGTGATGATTCTCGAGAATCATCACTTTCTTGGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1163s1c1
Sequence:CCGGCACAGTTTCAATTCAGAAGTTCTCGAGAACTTCTGAATTGAAACTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1033s1c1
Sequence:CCGGGCATGGGCATTTCTTCCTGTTCTCGAGAACAGGAAGAAATGCCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379214
H1FX-AS1 MISSION shRNA shRNA Plasmid DNA
H1FX antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2763s1c1
Sequence:CCGGCATCCCATTCTATCTGAACAACTCGAGTTGTTCAGATAGAATGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1387s1c1
Sequence:CCGGGCAAAGCAATGGCTTCTTCAACTCGAGTTGAAGAAGCCATTGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2990s1c1
Sequence:CCGGGCGTTGTTAAAGTTTGTTGATCTCGAGATCAACAAACTTTAACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2956s1c1
Sequence:CCGGGACTCCAAGAAAGTGATGATTCTCGAGAATCATCACTTTCTTGGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1163s1c1
Sequence:CCGGCACAGTTTCAATTCAGAAGTTCTCGAGAACTTCTGAATTGAAACTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1033s1c1
Sequence:CCGGGCATGGGCATTTCTTCCTGTTCTCGAGAACAGGAAGAAATGCCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379214
H1FX-AS1 MISSION shRNA Lentiviral Transduction Particles
H1FX antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2763s1c1
Sequence:CCGGCATCCCATTCTATCTGAACAACTCGAGTTGTTCAGATAGAATGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1387s1c1
Sequence:CCGGGCAAAGCAATGGCTTCTTCAACTCGAGTTGAAGAAGCCATTGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2990s1c1
Sequence:CCGGGCGTTGTTAAAGTTTGTTGATCTCGAGATCAACAAACTTTAACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-2956s1c1
Sequence:CCGGGACTCCAAGAAAGTGATGATTCTCGAGAATCATCACTTTCTTGGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1163s1c1
Sequence:CCGGCACAGTTTCAATTCAGAAGTTCTCGAGAACTTCTGAATTGAAACTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_379214.2-1033s1c1
Sequence:CCGGGCATGGGCATTTCTTCCTGTTCTCGAGAACAGGAAGAAATGCCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)