EMAIL THIS PAGE TO A FRIEND

H1FX

H1 histone family, member X

53 Gene Product Result for
Synonyms: H1X
UniProtKB ID: Q92522
Gene ID:
Human(8971) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H1 family. [provided by RefSeq, Jul 2008]
Mouse(243529) H1 histone family, member X
Rat(500252) H1 histone family, member X
Zebrafish(322508) H1 histone family, member X
chicken(427585) H1 histone family, member X
cow(511901) H1 histone family, member X
dog(484627) H1 histone family, member X
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006026 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006026 Rosetta Predictions human pricing
XM_001075299 Rosetta Predictions rat pricing
XM_575600 Rosetta Predictions rat pricing
NM_198622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089860 predicted 1188
2 SASI_Hs01_00089861 predicted 1189
3 SASI_Hs01_00089862 predicted 1146
4 SASI_Hs01_00089863 predicted 1254
5 SASI_Hs01_00089864 predicted 1224
6 SASI_Hs01_00089865 predicted 1221
7 SASI_Hs01_00089868 predicted 1117
8 SASI_Hs01_00089866 predicted 1249
9 SASI_Hs01_00089869 predicted 1114
10 SASI_Hs01_00089867 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349205 predicted 261
2 SASI_Rn02_00349206 predicted 308
3 SASI_Rn02_00349207 predicted 258
4 SASI_Rn02_00349208 predicted 207
5 SASI_Rn02_00349209 predicted 271
6 SASI_Rn02_00349210 predicted 199
7 SASI_Rn02_00349211 predicted 215
8 SASI_Rn02_00349212 predicted 278
9 SASI_Rn02_00349213 predicted 306
10 SASI_Rn02_00349214 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403883 predicted 264
2 SASI_Rn02_00403884 predicted 303
3 SASI_Rn02_00403885 predicted 263
4 SASI_Rn02_00403886 predicted 216
5 SASI_Rn02_00403887 predicted 268
6 SASI_Rn02_00403888 predicted 204
7 SASI_Rn02_00403889 predicted 218
8 SASI_Rn02_00403890 predicted 280
9 SASI_Rn02_00403891 predicted 308
10 SASI_Rn02_00403892 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126789 predicted 373
2 SASI_Mm01_00126790 predicted 445
3 SASI_Mm02_00351068 predicted 375
4 SASI_Mm01_00126791 predicted 312
5 SASI_Mm02_00351069 predicted 372
6 SASI_Mm01_00126792 predicted 433
7 SASI_Mm01_00126793 predicted 455
8 SASI_Mm01_00126794 predicted 377
9 SASI_Mm01_00126795 predicted 378
10 SASI_Mm02_00351070 predicted 406
11 SASI_Mm01_00126796 predicted 409
12 SASI_Mm01_00126797 predicted 402
13 SASI_Mm01_00126798 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198622
H1FX MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member X
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-409s1c1
Sequence:CCGGCTGGTGCAGAACGATACGCTACTCGAGTAGCGTATCGTTCTGCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-627s1c1
Sequence:CCGGCAGCGCGAAGAAAGTGAAGAACTCGAGTTCTTCACTTTCTTCGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-462s1c1
Sequence:CCGGCTTCAAGCTGAACCGCAAGAACTCGAGTTCTTGCGGTTCAGCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198622.1-844s1c1
Sequence:CCGGGCGTTCTGTTTGCTTTAGGTTCTCGAGAACCTAAAGCAAACAGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-453s1c1
Sequence:CCGGCAACGGATCCTTCAAGCTGAACTCGAGTTCAGCTTGAAGGATCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-462s21c1
Sequence:CCGGCTTCAAGCTGAACCGCAAGAACTCGAGTTCTTGCGGTTCAGCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198622.1-844s21c1
Sequence:CCGGGCGTTCTGTTTGCTTTAGGTTCTCGAGAACCTAAAGCAAACAGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-627s21c1
Sequence:CCGGCAGCGCGAAGAAAGTGAAGAACTCGAGTTCTTCACTTTCTTCGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-453s21c1
Sequence:CCGGCAACGGATCCTTCAAGCTGAACTCGAGTTCAGCTTGAAGGATCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198622
H1FX MISSION shRNA shRNA Plasmid DNA
H1 histone family, member X
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-409s1c1
Sequence:CCGGCTGGTGCAGAACGATACGCTACTCGAGTAGCGTATCGTTCTGCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-627s1c1
Sequence:CCGGCAGCGCGAAGAAAGTGAAGAACTCGAGTTCTTCACTTTCTTCGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-462s1c1
Sequence:CCGGCTTCAAGCTGAACCGCAAGAACTCGAGTTCTTGCGGTTCAGCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198622.1-844s1c1
Sequence:CCGGGCGTTCTGTTTGCTTTAGGTTCTCGAGAACCTAAAGCAAACAGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-453s1c1
Sequence:CCGGCAACGGATCCTTCAAGCTGAACTCGAGTTCAGCTTGAAGGATCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-462s21c1
Sequence:CCGGCTTCAAGCTGAACCGCAAGAACTCGAGTTCTTGCGGTTCAGCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198622.1-844s21c1
Sequence:CCGGGCGTTCTGTTTGCTTTAGGTTCTCGAGAACCTAAAGCAAACAGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-627s21c1
Sequence:CCGGCAGCGCGAAGAAAGTGAAGAACTCGAGTTCTTCACTTTCTTCGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-453s21c1
Sequence:CCGGCAACGGATCCTTCAAGCTGAACTCGAGTTCAGCTTGAAGGATCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198622
H1FX MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member X
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-409s1c1
Sequence:CCGGCTGGTGCAGAACGATACGCTACTCGAGTAGCGTATCGTTCTGCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-627s1c1
Sequence:CCGGCAGCGCGAAGAAAGTGAAGAACTCGAGTTCTTCACTTTCTTCGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-462s1c1
Sequence:CCGGCTTCAAGCTGAACCGCAAGAACTCGAGTTCTTGCGGTTCAGCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198622.1-844s1c1
Sequence:CCGGGCGTTCTGTTTGCTTTAGGTTCTCGAGAACCTAAAGCAAACAGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198622.1-453s1c1
Sequence:CCGGCAACGGATCCTTCAAGCTGAACTCGAGTTCAGCTTGAAGGATCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-462s21c1
Sequence:CCGGCTTCAAGCTGAACCGCAAGAACTCGAGTTCTTGCGGTTCAGCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316278    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198622.1-844s21c1
Sequence:CCGGGCGTTCTGTTTGCTTTAGGTTCTCGAGAACCTAAAGCAAACAGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-627s21c1
Sequence:CCGGCAGCGCGAAGAAAGTGAAGAACTCGAGTTCTTCACTTTCTTCGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198622.1-453s21c1
Sequence:CCGGCAACGGATCCTTCAAGCTGAACTCGAGTTCAGCTTGAAGGATCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006026
VALIDATED
H1FX MISSION shRNA Bacterial Glycerol Stock
H1 histone family, member X
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-604s1c1
Sequence:CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-702s1c1
Sequence:CCGGCAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-633s1c1
Sequence:CCGGCTACCTCAAGTACTCGATCAACTCGAGTTGATCGAGTACTTGAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-898s1c1
Sequence:CCGGGCTGGCGCCAAGAAGGACAAACTCGAGTTTGTCCTTCTTGGCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-465s1c1
Sequence:CCGGCCCATCTAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-1260s21c1
Sequence:CCGGACGGCCGTCGTCATGGTTACTCTCGAGAGTAACCATGACGACGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-637s21c1
Sequence:CCGGTACCTCAAGTACTCGATCAAGCTCGAGCTTGATCGAGTACTTGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-607s21c1
Sequence:CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-468s21c1
Sequence:CCGGCCCATCTAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-1194s21c1
Sequence:CCGGTTCGTTGTTTGCTTTAGGTTTCTCGAGAAACCTAAAGCAAACAACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-582s21c1
Sequence:CCGGGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-901s21c1
Sequence:CCGGGCTGGCGCCAAGAAGGACAAACTCGAGTTTGTCCTTCTTGGCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006026
VALIDATED
H1FX MISSION shRNA shRNA Plasmid DNA
H1 histone family, member X
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-604s1c1
Sequence:CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-702s1c1
Sequence:CCGGCAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-633s1c1
Sequence:CCGGCTACCTCAAGTACTCGATCAACTCGAGTTGATCGAGTACTTGAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-898s1c1
Sequence:CCGGGCTGGCGCCAAGAAGGACAAACTCGAGTTTGTCCTTCTTGGCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-465s1c1
Sequence:CCGGCCCATCTAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-1260s21c1
Sequence:CCGGACGGCCGTCGTCATGGTTACTCTCGAGAGTAACCATGACGACGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-637s21c1
Sequence:CCGGTACCTCAAGTACTCGATCAAGCTCGAGCTTGATCGAGTACTTGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-607s21c1
Sequence:CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-468s21c1
Sequence:CCGGCCCATCTAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-1194s21c1
Sequence:CCGGTTCGTTGTTTGCTTTAGGTTTCTCGAGAAACCTAAAGCAAACAACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-582s21c1
Sequence:CCGGGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-901s21c1
Sequence:CCGGGCTGGCGCCAAGAAGGACAAACTCGAGTTTGTCCTTCTTGGCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006026
VALIDATED
H1FX MISSION shRNA Lentiviral Transduction Particles
H1 histone family, member X
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-604s1c1
Sequence:CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-702s1c1
Sequence:CCGGCAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-633s1c1
Sequence:CCGGCTACCTCAAGTACTCGATCAACTCGAGTTGATCGAGTACTTGAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-898s1c1
Sequence:CCGGGCTGGCGCCAAGAAGGACAAACTCGAGTTTGTCCTTCTTGGCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006026.2-465s1c1
Sequence:CCGGCCCATCTAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-1260s21c1
Sequence:CCGGACGGCCGTCGTCATGGTTACTCTCGAGAGTAACCATGACGACGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-637s21c1
Sequence:CCGGTACCTCAAGTACTCGATCAAGCTCGAGCTTGATCGAGTACTTGAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-607s21c1
Sequence:CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-468s21c1
Sequence:CCGGCCCATCTAAGAAGAGGAAGAACTCGAGTTCTTCCTCTTCTTAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-1194s21c1
Sequence:CCGGTTCGTTGTTTGCTTTAGGTTTCTCGAGAAACCTAAAGCAAACAACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006026.3-582s21c1
Sequence:CCGGGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006026.3-901s21c1
Sequence:CCGGGCTGGCGCCAAGAAGGACAAACTCGAGTTTGTCCTTCTTGGCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)