EMAIL THIS PAGE TO A FRIEND

H2AFB1

H2A histone family, member B1

34 Gene Product Result for
Synonyms: H2A.Bbd
UniProtKB ID: P0C5Y9, A0PK90, P98176, Q5TZB2, Q6FG78, Q96PR7
Gene ID:
Human(474382) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most centromeric copy which is in intron 22 of the F8 gene. [provided by RefSeq, Jul 2008]
Mouse(68231) H2A histone family, member B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017990 Rosetta Predictions human pricing
NM_026627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056586 predicted 75
2 SASI_Hs01_00056587 predicted 132
3 SASI_Hs01_00056588 predicted 25
4 SASI_Hs01_00056589 predicted 159
5 SASI_Hs01_00056590 predicted 338
6 SASI_Hs01_00056591 predicted 74
7 SASI_Hs01_00056592 predicted 339
8 SASI_Hs01_00056593 predicted 61
9 SASI_Hs01_00056594 predicted 105
10 SASI_Hs02_00306878 predicted 164
11 SASI_Hs01_00056585 predicted 176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069442 predicted 218
2 SASI_Mm02_00330597 predicted 193
3 SASI_Mm01_00069446 predicted 162
4 SASI_Mm01_00069448 predicted 306
5 SASI_Mm01_00069449 predicted 439
6 SASI_Mm02_00330598 predicted 485
7 SASI_Mm02_00330599 predicted 94
8 SASI_Mm02_00330600 predicted 486
9 SASI_Mm02_00330601 predicted 156
10 SASI_Mm02_00330602 predicted 448
11 SASI_Mm01_00069443 predicted 246
12 SASI_Mm01_00069444 predicted 129
13 SASI_Mm01_00069445 predicted 172
14 SASI_Mm01_00069447 predicted 377
15 SASI_Mm01_00069450 predicted 116
16 SASI_Mm01_00069451 predicted 484
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017990
H2AFB1 MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member B1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-279s1c1
Sequence:CCGGGTGGTTCACAACGACAGGCTACTCGAGTAGCCTGTCGTTGTGAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-264s1c1
Sequence:CCGGCTGCTGCTGGACATGGTGGTTCTCGAGAACCACCATGTCCAGCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-176s1c1
Sequence:CCGGCGCTGCGGTTATTGAGTACCTCTCGAGAGGTACTCAATAACCGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-292s1c1
Sequence:CCGGACAGGCTACTGAGCACCCTTTCTCGAGAAAGGGTGCTCAGTAGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-274s1c1
Sequence:CCGGACATGGTGGTTCACAACGACACTCGAGTGTCGTTGTGAACCACCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017990
H2AFB1 MISSION shRNA shRNA Plasmid DNA
H2A histone family, member B1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-279s1c1
Sequence:CCGGGTGGTTCACAACGACAGGCTACTCGAGTAGCCTGTCGTTGTGAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-264s1c1
Sequence:CCGGCTGCTGCTGGACATGGTGGTTCTCGAGAACCACCATGTCCAGCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-176s1c1
Sequence:CCGGCGCTGCGGTTATTGAGTACCTCTCGAGAGGTACTCAATAACCGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-292s1c1
Sequence:CCGGACAGGCTACTGAGCACCCTTTCTCGAGAAAGGGTGCTCAGTAGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-274s1c1
Sequence:CCGGACATGGTGGTTCACAACGACACTCGAGTGTCGTTGTGAACCACCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017990
H2AFB1 MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member B1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-279s1c1
Sequence:CCGGGTGGTTCACAACGACAGGCTACTCGAGTAGCCTGTCGTTGTGAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-264s1c1
Sequence:CCGGCTGCTGCTGGACATGGTGGTTCTCGAGAACCACCATGTCCAGCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-176s1c1
Sequence:CCGGCGCTGCGGTTATTGAGTACCTCTCGAGAGGTACTCAATAACCGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-292s1c1
Sequence:CCGGACAGGCTACTGAGCACCCTTTCTCGAGAAAGGGTGCTCAGTAGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017990.1-274s1c1
Sequence:CCGGACATGGTGGTTCACAACGACACTCGAGTGTCGTTGTGAACCACCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026627
H2AFB1 MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member B1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-229s1c1
Sequence:CCGGGCTCGAGTACTTAACATCTAACTCGAGTTAGATGTTAAGTACTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-320s1c1
Sequence:CCGGCGTGTGGTACAGAACAACGAACTCGAGTTCGTTGTTCTGTACCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-308s1c1
Sequence:CCGGGAGCATGTGTGCCGTGTGGTACTCGAGTACCACACGGCACACATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-165s1c1
Sequence:CCGGTCCTACGAGAGGGAAACTATTCTCGAGAATAGTTTCCCTCTCGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-240s21c1
Sequence:CCGGTAACATCTAACATCCTTGAACCTCGAGGTTCAAGGATGTTAGATGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-206s1c1
Sequence:CCGGGCTCCTGTATTCCTCGCGGGTCTCGAGACCCGCGAGGAATACAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-342s21c1
Sequence:CCGGAGCTCCACCAACTCTTCAAACCTCGAGGTTTGAAGAGTTGGTGGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-146s21c1
Sequence:CCGGGTTAGCCGTGTGGATCGTTTCCTCGAGGAAACGATCCACACGGCTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026627
H2AFB1 MISSION shRNA shRNA Plasmid DNA
H2A histone family, member B1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-229s1c1
Sequence:CCGGGCTCGAGTACTTAACATCTAACTCGAGTTAGATGTTAAGTACTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-320s1c1
Sequence:CCGGCGTGTGGTACAGAACAACGAACTCGAGTTCGTTGTTCTGTACCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-308s1c1
Sequence:CCGGGAGCATGTGTGCCGTGTGGTACTCGAGTACCACACGGCACACATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-165s1c1
Sequence:CCGGTCCTACGAGAGGGAAACTATTCTCGAGAATAGTTTCCCTCTCGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-240s21c1
Sequence:CCGGTAACATCTAACATCCTTGAACCTCGAGGTTCAAGGATGTTAGATGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-206s1c1
Sequence:CCGGGCTCCTGTATTCCTCGCGGGTCTCGAGACCCGCGAGGAATACAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-342s21c1
Sequence:CCGGAGCTCCACCAACTCTTCAAACCTCGAGGTTTGAAGAGTTGGTGGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-146s21c1
Sequence:CCGGGTTAGCCGTGTGGATCGTTTCCTCGAGGAAACGATCCACACGGCTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026627
H2AFB1 MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member B1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-229s1c1
Sequence:CCGGGCTCGAGTACTTAACATCTAACTCGAGTTAGATGTTAAGTACTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-320s1c1
Sequence:CCGGCGTGTGGTACAGAACAACGAACTCGAGTTCGTTGTTCTGTACCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-308s1c1
Sequence:CCGGGAGCATGTGTGCCGTGTGGTACTCGAGTACCACACGGCACACATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-165s1c1
Sequence:CCGGTCCTACGAGAGGGAAACTATTCTCGAGAATAGTTTCCCTCTCGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-240s21c1
Sequence:CCGGTAACATCTAACATCCTTGAACCTCGAGGTTCAAGGATGTTAGATGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026627.1-206s1c1
Sequence:CCGGGCTCCTGTATTCCTCGCGGGTCTCGAGACCCGCGAGGAATACAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-342s21c1
Sequence:CCGGAGCTCCACCAACTCTTCAAACCTCGAGGTTTGAAGAGTTGGTGGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026627.1-146s21c1
Sequence:CCGGGTTAGCCGTGTGGATCGTTTCCTCGAGGAAACGATCCACACGGCTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)