EMAIL THIS PAGE TO A FRIEND

H2AFB2

H2A histone family, member B2

12 Gene Product Result for
Synonyms: H2A.Bbd
Species: Human H2AFB2(474381)
UniProtKB ID: P0C5Z0, A1L4E4, P98176, Q5TZB2, Q6FG78, Q96PR7
Gene ID:
Human(474381) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the middle copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017991 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017991 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090689 predicted 68
2 SASI_Hs01_00090690 predicted 119
3 SASI_Hs01_00090691 predicted 13
4 SASI_Hs01_00090692 predicted 148
5 SASI_Hs01_00090693 predicted 150
6 SASI_Hs01_00090694 predicted 62
7 SASI_Hs01_00090695 predicted 124
8 SASI_Hs01_00090696 predicted 156
9 SASI_Hs01_00090697 predicted 51
10 SASI_Hs01_00090698 predicted 144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017991
H2AFB2 MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member B2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-127s21c1
Sequence:CCGGCACTACGCTCAGCGCCTGAGTCTCGAGACTCAGGCGCTGAGCGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-70s21c1
Sequence:CCGGGTCCGAGCGGAGCTTTCGTTTCTCGAGAAACGAAAGCTCCGCTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-89s21c1
Sequence:CCGGTTTCAGTGAGCCAGGTGGAGCCTCGAGGCTCCACCTGGCTCACTGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-160s21c1
Sequence:CCGGGTCTACCTCGCTGCGGTTATTCTCGAGAATAACCGCAGCGAGGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-171s21c1
Sequence:CCGGTGCGGTTATTGAGTACCTGACCTCGAGGTCAGGTACTCAATAACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017991
H2AFB2 MISSION shRNA shRNA Plasmid DNA
H2A histone family, member B2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-127s21c1
Sequence:CCGGCACTACGCTCAGCGCCTGAGTCTCGAGACTCAGGCGCTGAGCGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-70s21c1
Sequence:CCGGGTCCGAGCGGAGCTTTCGTTTCTCGAGAAACGAAAGCTCCGCTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-89s21c1
Sequence:CCGGTTTCAGTGAGCCAGGTGGAGCCTCGAGGCTCCACCTGGCTCACTGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-160s21c1
Sequence:CCGGGTCTACCTCGCTGCGGTTATTCTCGAGAATAACCGCAGCGAGGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-171s21c1
Sequence:CCGGTGCGGTTATTGAGTACCTGACCTCGAGGTCAGGTACTCAATAACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017991
H2AFB2 MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member B2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-127s21c1
Sequence:CCGGCACTACGCTCAGCGCCTGAGTCTCGAGACTCAGGCGCTGAGCGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-70s21c1
Sequence:CCGGGTCCGAGCGGAGCTTTCGTTTCTCGAGAAACGAAAGCTCCGCTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-89s21c1
Sequence:CCGGTTTCAGTGAGCCAGGTGGAGCCTCGAGGCTCCACCTGGCTCACTGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-160s21c1
Sequence:CCGGGTCTACCTCGCTGCGGTTATTCTCGAGAATAACCGCAGCGAGGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017991.1-171s21c1
Sequence:CCGGTGCGGTTATTGAGTACCTGACCTCGAGGTCAGGTACTCAATAACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)