EMAIL THIS PAGE TO A FRIEND

H2AFB3

H2A histone family, member B3

27 Gene Product Result for
Synonyms: H2ABBD H2AFB
Gene ID:
Human(83740) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. This gene is part of a region that is repeated three times on chromosome X, once in intron 22 of the F8 gene and twice closer to the Xq telomere. This record represents the most telomeric copy. [provided by RefSeq, Jul 2008]
Rat(302783) H2A histone family, member B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301134 ANTI-H2AB2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU231361 MISSION® esiRNA esiRNA targeting human H2AFB3 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080720 Rosetta Predictions human pricing
NM_001106969 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153769 predicted 70
2 SASI_Hs01_00153770 predicted 123
3 SASI_Hs01_00153771 predicted 26
4 SASI_Hs01_00153772 predicted 161
5 SASI_Hs01_00153773 predicted 346
6 SASI_Hs01_00153774 predicted 74
7 SASI_Hs01_00153775 predicted 337
8 SASI_Hs01_00153776 predicted 57
9 SASI_Hs01_00153777 predicted 104
10 SASI_Hs02_00362495 predicted 169
11 SASI_Hs01_00153768 predicted 185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224196 predicted 288
2 SASI_Rn02_00224197 predicted 47
3 SASI_Rn02_00224198 predicted 296
4 SASI_Rn02_00224199 predicted 128
5 SASI_Rn02_00224200 predicted 12
6 SASI_Rn02_00224201 predicted 97
7 SASI_Rn02_00224202 predicted 211
8 SASI_Rn02_00224203 predicted 286
9 SASI_Rn02_00224204 predicted 42
10 SASI_Rn02_00224205 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080720
H2AFB3 MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member B3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080720.1-372s1c1
Sequence:CCGGCCCTGGGACCTGACAGGTCCACTCGAGTGGACCTGTCAGGTCCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-178s1c1
Sequence:CCGGCTGCGGTTATTGAGTACCTGACTCGAGTCAGGTACTCAATAACCGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-291s1c1
Sequence:CCGGGACAGGCTACTGAGCACCCTTCTCGAGAAGGGTGCTCAGTAGCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-269s1c1
Sequence:CCGGGCTGGACATGGTGGTTCACAACTCGAGTTGTGAACCACCATGTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-165s1c1
Sequence:CCGGCCGGTCTACCTCGCTGCGGTTCTCGAGAACCGCAGCGAGGTAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080720
H2AFB3 MISSION shRNA shRNA Plasmid DNA
H2A histone family, member B3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080720.1-372s1c1
Sequence:CCGGCCCTGGGACCTGACAGGTCCACTCGAGTGGACCTGTCAGGTCCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-178s1c1
Sequence:CCGGCTGCGGTTATTGAGTACCTGACTCGAGTCAGGTACTCAATAACCGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-291s1c1
Sequence:CCGGGACAGGCTACTGAGCACCCTTCTCGAGAAGGGTGCTCAGTAGCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-269s1c1
Sequence:CCGGGCTGGACATGGTGGTTCACAACTCGAGTTGTGAACCACCATGTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-165s1c1
Sequence:CCGGCCGGTCTACCTCGCTGCGGTTCTCGAGAACCGCAGCGAGGTAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080720
H2AFB3 MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member B3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080720.1-372s1c1
Sequence:CCGGCCCTGGGACCTGACAGGTCCACTCGAGTGGACCTGTCAGGTCCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-178s1c1
Sequence:CCGGCTGCGGTTATTGAGTACCTGACTCGAGTCAGGTACTCAATAACCGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-291s1c1
Sequence:CCGGGACAGGCTACTGAGCACCCTTCTCGAGAAGGGTGCTCAGTAGCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-269s1c1
Sequence:CCGGGCTGGACATGGTGGTTCACAACTCGAGTTGTGAACCACCATGTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080720.1-165s1c1
Sequence:CCGGCCGGTCTACCTCGCTGCGGTTCTCGAGAACCGCAGCGAGGTAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)