EMAIL THIS PAGE TO A FRIEND

H2AFJ

H2A histone family, member J

94 Gene Product Result for
Synonyms: H2AJ
UniProtKB ID: Q9BTM1, Q9NV63
Gene ID:
Human(55766) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is located on chromosome 12 and encodes a variant H2A histone. The protein is divergent at the C-terminus compared to the consensus H2A histone family member. [provided by RefSeq, Jul 2008]
Mouse(232440) H2A histone family, member J
Rat(690795) H2A histone family, member J
cow(618489) H2A histone family, member J
dog(486669) H2A histone family, member J
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302403 ANTI-H2AFJ (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018267 Rosetta Predictions human pricing
NM_177925 Rosetta Predictions human pricing
NM_001109610 Rosetta Predictions rat pricing
NM_177688 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177130 predicted 997
2 SASI_Hs01_00177131 predicted 973
3 SASI_Hs01_00177132 predicted 981
4 SASI_Hs01_00177133 predicted 951
5 SASI_Hs01_00177134 predicted 1020
6 SASI_Hs01_00177135 predicted 1034
7 SASI_Hs01_00177136 predicted 1036
8 SASI_Hs01_00177137 predicted 206
9 SASI_Hs01_00177138 predicted 1062
10 SASI_Hs01_00177139 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369413 predicted 798
2 SASI_Hs01_00102817 predicted 226
3 SASI_Hs01_00102819 predicted 332
4 SASI_Hs02_00369414 predicted 998
5 SASI_Hs02_00369415 predicted 815
6 SASI_Hs02_00369416 predicted 970
7 SASI_Hs02_00369417 predicted 658
8 SASI_Hs02_00369418 predicted 957
9 SASI_Hs01_00102826 predicted 141
10 SASI_Hs02_00369419 predicted 952
11 SASI_Hs01_00102818 predicted 313
12 SASI_Hs01_00102820 predicted 318
13 SASI_Hs01_00102821 predicted 324
14 SASI_Hs01_00102822 predicted 317
15 SASI_Hs01_00102823 predicted 315
16 SASI_Hs01_00102824 predicted 324
17 SASI_Hs01_00102825 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250067 predicted 439
2 SASI_Rn02_00250068 predicted 440
3 SASI_Rn02_00250069 predicted 412
4 SASI_Rn02_00250070 predicted 443
5 SASI_Rn02_00250071 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146742 predicted 518
2 SASI_Mm01_00146743 predicted 836
3 SASI_Mm01_00146744 predicted 915
4 SASI_Mm01_00146745 predicted 523
5 SASI_Mm01_00146746 predicted 971
6 SASI_Mm01_00146747 predicted 677
7 SASI_Mm01_00146749 predicted 719
8 SASI_Mm01_00146750 predicted 707
9 SASI_Mm01_00146751 predicted 964
10 SASI_Mm02_00348020 predicted 959
11 SASI_Mm01_00146748 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177925
VALIDATED
H2AFJ MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member J
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-389s1c1
Sequence:CCGGGTTAAACAAGCTGCTGGGCAACTCGAGTTGCCCAGCAGCTTGTTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_177925.1-277s1c1
Sequence:CCGGTGGAGTACCTTACGGCGGAGACTCGAGTCTCCGCCGTAAGGTACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_177925.1-470s1c1
Sequence:CCGGGACGGAGAGTCAGAAGACGAACTCGAGTTCGTCTTCTGACTCTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-327s1c1
Sequence:CCGGGACAACAAGAAGACCAGGATACTCGAGTATCCTGGTCTTCTTGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-137s1c1
Sequence:CCGGCAAAGTGCGAGCAAAGGCCAACTCGAGTTGGCCTTTGCTCGCACTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-227s21c1
Sequence:CCGGTGCACAGACTGCTGCGCAAAGCTCGAGCTTTGCGCAGCAGTCTGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-916s21c1
Sequence:CCGGTGAGGCCTCCTTCGGAATTATCTCGAGATAATTCCGAAGGAGGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-302s21c1
Sequence:CCGGTGGAGTACCTTACGGCGGAGACTCGAGTCTCCGCCGTAAGGTACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-495s21c1
Sequence:CCGGGACGGAGAGTCAGAAGACGAACTCGAGTTCGTCTTCTGACTCTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177925.2-511s21c1
Sequence:CCGGACGAAGAGCAAATGACCCTGACTCGAGTCAGGGTCATTTGCTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177925
VALIDATED
H2AFJ MISSION shRNA shRNA Plasmid DNA
H2A histone family, member J
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-389s1c1
Sequence:CCGGGTTAAACAAGCTGCTGGGCAACTCGAGTTGCCCAGCAGCTTGTTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_177925.1-277s1c1
Sequence:CCGGTGGAGTACCTTACGGCGGAGACTCGAGTCTCCGCCGTAAGGTACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_177925.1-470s1c1
Sequence:CCGGGACGGAGAGTCAGAAGACGAACTCGAGTTCGTCTTCTGACTCTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-327s1c1
Sequence:CCGGGACAACAAGAAGACCAGGATACTCGAGTATCCTGGTCTTCTTGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-137s1c1
Sequence:CCGGCAAAGTGCGAGCAAAGGCCAACTCGAGTTGGCCTTTGCTCGCACTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-227s21c1
Sequence:CCGGTGCACAGACTGCTGCGCAAAGCTCGAGCTTTGCGCAGCAGTCTGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-916s21c1
Sequence:CCGGTGAGGCCTCCTTCGGAATTATCTCGAGATAATTCCGAAGGAGGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-302s21c1
Sequence:CCGGTGGAGTACCTTACGGCGGAGACTCGAGTCTCCGCCGTAAGGTACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-495s21c1
Sequence:CCGGGACGGAGAGTCAGAAGACGAACTCGAGTTCGTCTTCTGACTCTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177925.2-511s21c1
Sequence:CCGGACGAAGAGCAAATGACCCTGACTCGAGTCAGGGTCATTTGCTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177925
VALIDATED
H2AFJ MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member J
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-389s1c1
Sequence:CCGGGTTAAACAAGCTGCTGGGCAACTCGAGTTGCCCAGCAGCTTGTTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_177925.1-277s1c1
Sequence:CCGGTGGAGTACCTTACGGCGGAGACTCGAGTCTCCGCCGTAAGGTACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_177925.1-470s1c1
Sequence:CCGGGACGGAGAGTCAGAAGACGAACTCGAGTTCGTCTTCTGACTCTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-327s1c1
Sequence:CCGGGACAACAAGAAGACCAGGATACTCGAGTATCCTGGTCTTCTTGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177925.1-137s1c1
Sequence:CCGGCAAAGTGCGAGCAAAGGCCAACTCGAGTTGGCCTTTGCTCGCACTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-227s21c1
Sequence:CCGGTGCACAGACTGCTGCGCAAAGCTCGAGCTTTGCGCAGCAGTCTGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-916s21c1
Sequence:CCGGTGAGGCCTCCTTCGGAATTATCTCGAGATAATTCCGAAGGAGGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-302s21c1
Sequence:CCGGTGGAGTACCTTACGGCGGAGACTCGAGTCTCCGCCGTAAGGTACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_177925.2-495s21c1
Sequence:CCGGGACGGAGAGTCAGAAGACGAACTCGAGTTCGTCTTCTGACTCTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177925.2-511s21c1
Sequence:CCGGACGAAGAGCAAATGACCCTGACTCGAGTCAGGGTCATTTGCTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177688
H2AFJ MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member J
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177688.2-446s1c1
Sequence:CCGGGCAGCCAATAAAGTCGGTGAACTCGAGTTCACCGACTTTATTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-383s1c1
Sequence:CCGGGAGCCAGAAGGTGAAGAGCAACTCGAGTTGCTCTTCACCTTCTGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-248s1c1
Sequence:CCGGGCGCATCATCCCTCGTCACCTCTCGAGAGGTGACGAGGGATGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-116s1c1
Sequence:CCGGGCTGCTGCGGAAGGGCAACTACTCGAGTAGTTGCCCTTCCGCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-341s1c1
Sequence:CCGGCCTGCCCAATATCCAGGCCGTCTCGAGACGGCCTGGATATTGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177688
H2AFJ MISSION shRNA shRNA Plasmid DNA
H2A histone family, member J
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177688.2-446s1c1
Sequence:CCGGGCAGCCAATAAAGTCGGTGAACTCGAGTTCACCGACTTTATTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-383s1c1
Sequence:CCGGGAGCCAGAAGGTGAAGAGCAACTCGAGTTGCTCTTCACCTTCTGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-248s1c1
Sequence:CCGGGCGCATCATCCCTCGTCACCTCTCGAGAGGTGACGAGGGATGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-116s1c1
Sequence:CCGGGCTGCTGCGGAAGGGCAACTACTCGAGTAGTTGCCCTTCCGCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-341s1c1
Sequence:CCGGCCTGCCCAATATCCAGGCCGTCTCGAGACGGCCTGGATATTGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177688
H2AFJ MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member J
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177688.2-446s1c1
Sequence:CCGGGCAGCCAATAAAGTCGGTGAACTCGAGTTCACCGACTTTATTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-383s1c1
Sequence:CCGGGAGCCAGAAGGTGAAGAGCAACTCGAGTTGCTCTTCACCTTCTGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-248s1c1
Sequence:CCGGGCGCATCATCCCTCGTCACCTCTCGAGAGGTGACGAGGGATGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-116s1c1
Sequence:CCGGGCTGCTGCGGAAGGGCAACTACTCGAGTAGTTGCCCTTCCGCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177688.2-341s1c1
Sequence:CCGGCCTGCCCAATATCCAGGCCGTCTCGAGACGGCCTGGATATTGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)