EMAIL THIS PAGE TO A FRIEND

H2AFV

H2A histone family, member V

119 Gene Product Result for
Synonyms: H2A.Z-2 H2AV
Gene ID:
Human(94239) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. Several transcript variants encoding different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(77605) H2A histone family, member V
chicken(426617) H2A histone family, member V
cow(613618) H2A histone family, member V
dog(475501) H2A histone family, member V
Domestic Rabbit(100328558) H2A histone family, member V
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201517 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_126043 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126043 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126043 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114011 MISSION® esiRNA esiRNA human H2AFV (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012412 Rosetta Predictions human pricing
NM_138635 Rosetta Predictions human pricing
NM_201436 Rosetta Predictions human pricing
NM_201516 Rosetta Predictions human pricing
NM_201517 Rosetta Predictions human pricing
XM_001476068 Rosetta Predictions mouse pricing
XM_126043 Rosetta Predictions mouse pricing
XM_907680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063989 predicted 688
2 SASI_Hs01_00063990 predicted 672
3 SASI_Hs01_00063991 predicted 681
4 SASI_Hs01_00063992 predicted 725
5 SASI_Hs01_00063993 predicted 724
6 SASI_Hs01_00063994 predicted 722
7 SASI_Hs01_00063995 predicted 680
8 SASI_Hs01_00063996 predicted 682
9 SASI_Hs01_00063997 predicted 686
10 SASI_Hs02_00344263 predicted 689
11 SASI_Hs01_00063988 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363765 predicted 766
2 SASI_Hs02_00363766 predicted 643
3 SASI_Hs02_00363767 predicted 621
4 SASI_Hs01_00140902 predicted 593
5 SASI_Hs01_00140903 predicted 431
6 SASI_Hs02_00363768 predicted 793
7 SASI_Hs01_00140906 predicted 380
8 SASI_Hs02_00363769 predicted 664
9 SASI_Hs01_00140908 predicted 402
10 SASI_Hs02_00363770 predicted 618
11 SASI_Hs01_00140901 predicted 471
12 SASI_Hs01_00140904 predicted 528
13 SASI_Hs01_00140905 predicted 401
14 SASI_Hs01_00140907 predicted 405
15 SASI_Hs01_00140909 predicted 376
16 SASI_Hs01_00140910 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372974 predicted 652
2 SASI_Hs01_00060745 predicted 614
3 SASI_Hs01_00060746 predicted 600
4 SASI_Hs01_00060747 predicted 600
5 SASI_Hs01_00060748 predicted 649
6 SASI_Hs01_00060749 predicted 643
7 SASI_Hs01_00060750 predicted 650
8 SASI_Hs01_00060751 predicted 603
9 SASI_Hs01_00060752 predicted 607
10 SASI_Hs01_00060753 predicted 607
11 SASI_Hs01_00060744 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144258 predicted 553
2 SASI_Hs01_00144259 predicted 545
3 SASI_Hs01_00144260 predicted 549
4 SASI_Hs01_00144261 predicted 599
5 SASI_Hs01_00144262 predicted 591
6 SASI_Hs01_00144263 predicted 597
7 SASI_Hs01_00144264 predicted 551
8 SASI_Hs01_00144265 predicted 553
9 SASI_Hs01_00144266 predicted 549
10 SASI_Hs02_00372995 predicted 558
11 SASI_Hs01_00144257 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170497 predicted 612
2 SASI_Hs01_00170498 predicted 610
3 SASI_Hs01_00170499 predicted 605
4 SASI_Hs01_00170493 predicted 564
5 SASI_Hs01_00170494 predicted 578
6 SASI_Hs01_00170495 predicted 564
7 SASI_Hs01_00170496 predicted 566
8 SASI_Hs01_00170500 predicted 572
9 SASI_Hs01_00170501 predicted 568
10 SASI_Hs01_00170502 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00386739 predicted 297
2 SASI_Mm02_00386740 predicted 303
3 SASI_Mm02_00386741 predicted 295
4 SASI_Mm02_00386742 predicted 324
5 SASI_Mm02_00386743 predicted 302
6 SASI_Mm02_00386744 predicted 305
7 SASI_Mm02_00386745 predicted 298
8 SASI_Mm02_00386746 predicted 316
9 SASI_Mm02_00386747 predicted 287
10 SASI_Mm02_00386748 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126043 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235492 predicted 300
2 SASI_Mm01_00235493 predicted 421
3 SASI_Mm01_00235494 predicted 391
4 SASI_Mm01_00235495 predicted 373
5 SASI_Mm01_00235496 predicted 446
6 SASI_Mm01_00235497 predicted 317
7 SASI_Mm01_00235498 predicted 349
8 SASI_Mm01_00235499 predicted 431
9 SASI_Mm01_00235500 predicted 317
10 SASI_Mm01_00235501 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433489 predicted 641
2 SASI_Mm02_00433490 predicted 722
3 SASI_Mm02_00433491 predicted 953
4 SASI_Mm02_00433492 predicted 906
5 SASI_Mm02_00433493 predicted 293
6 SASI_Mm02_00433494 predicted 301
7 SASI_Mm02_00433495 predicted 661
8 SASI_Mm02_00433496 predicted 737
9 SASI_Mm02_00433497 predicted 347
10 SASI_Mm02_00433498 predicted 889
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201517
VALIDATED
H2AFV MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member V
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-245s21c1
Sequence:CCGGGCTGGCAGGTAATGCTTCTAACTCGAGTTAGAAGCATTACCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-370s21c1
Sequence:CCGGTGATCCCTCACATCCACAAATCTCGAGATTTGTGGATGTGAGGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-422s21c1
Sequence:CCGGTGCTTAGAGGGATGCTTTAACCTCGAGGTTAAAGCATCCCTCTAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-336s21c1
Sequence:CCGGTCTCTTATCAAGGCTACCATACTCGAGTATGGTAGCCTTGATAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201517.2-826s21c1
Sequence:CCGGATGATTGATACCATGGTATATCTCGAGATATACCATGGTATCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201517.1-889s1c1
Sequence:CCGGCCTGCCAATTAAATCATGATACTCGAGTATCATGATTTAATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-320s1c1
Sequence:CCGGTCTCTTATCAAGGCTACCATACTCGAGTATGGTAGCCTTGATAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-379s1c1
Sequence:CCGGGATTGGAAAGAAGGGACAGCACTCGAGTGCTGTCCCTTCTTTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-249s1c1
Sequence:CCGGAGGATCTCAAAGTAAAGCGTACTCGAGTACGCTTTACTTTGAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-229s1c1
Sequence:CCGGGCTGGCAGGTAATGCTTCTAACTCGAGTTAGAAGCATTACCTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201517
VALIDATED
H2AFV MISSION shRNA shRNA Plasmid DNA
H2A histone family, member V
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-245s21c1
Sequence:CCGGGCTGGCAGGTAATGCTTCTAACTCGAGTTAGAAGCATTACCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-370s21c1
Sequence:CCGGTGATCCCTCACATCCACAAATCTCGAGATTTGTGGATGTGAGGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-422s21c1
Sequence:CCGGTGCTTAGAGGGATGCTTTAACCTCGAGGTTAAAGCATCCCTCTAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-336s21c1
Sequence:CCGGTCTCTTATCAAGGCTACCATACTCGAGTATGGTAGCCTTGATAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201517.2-826s21c1
Sequence:CCGGATGATTGATACCATGGTATATCTCGAGATATACCATGGTATCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201517.1-889s1c1
Sequence:CCGGCCTGCCAATTAAATCATGATACTCGAGTATCATGATTTAATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-320s1c1
Sequence:CCGGTCTCTTATCAAGGCTACCATACTCGAGTATGGTAGCCTTGATAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-379s1c1
Sequence:CCGGGATTGGAAAGAAGGGACAGCACTCGAGTGCTGTCCCTTCTTTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-249s1c1
Sequence:CCGGAGGATCTCAAAGTAAAGCGTACTCGAGTACGCTTTACTTTGAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-229s1c1
Sequence:CCGGGCTGGCAGGTAATGCTTCTAACTCGAGTTAGAAGCATTACCTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201517
VALIDATED
H2AFV MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member V
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-245s21c1
Sequence:CCGGGCTGGCAGGTAATGCTTCTAACTCGAGTTAGAAGCATTACCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-370s21c1
Sequence:CCGGTGATCCCTCACATCCACAAATCTCGAGATTTGTGGATGTGAGGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-422s21c1
Sequence:CCGGTGCTTAGAGGGATGCTTTAACCTCGAGGTTAAAGCATCCCTCTAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_201517.2-336s21c1
Sequence:CCGGTCTCTTATCAAGGCTACCATACTCGAGTATGGTAGCCTTGATAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303448    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201517.2-826s21c1
Sequence:CCGGATGATTGATACCATGGTATATCTCGAGATATACCATGGTATCAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106835    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201517.1-889s1c1
Sequence:CCGGCCTGCCAATTAAATCATGATACTCGAGTATCATGATTTAATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-320s1c1
Sequence:CCGGTCTCTTATCAAGGCTACCATACTCGAGTATGGTAGCCTTGATAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-379s1c1
Sequence:CCGGGATTGGAAAGAAGGGACAGCACTCGAGTGCTGTCCCTTCTTTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-249s1c1
Sequence:CCGGAGGATCTCAAAGTAAAGCGTACTCGAGTACGCTTTACTTTGAGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_201517.1-229s1c1
Sequence:CCGGGCTGGCAGGTAATGCTTCTAACTCGAGTTAGAAGCATTACCTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126043
VALIDATED
H2AFV MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member V
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-397s1c1
Sequence:CCGGGTGTTGGAGTTAGCAGGTAATCTCGAGATTACCTGCTAACTCCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-354s1c1
Sequence:CCGGTGCTGTGTACAGTGCCGCAATCTCGAGATTGCGGCACTGTACACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-370s1c1
Sequence:CCGGGCAATTCTGGAGTACCTCACACTCGAGTGTGAGGTACTCCAGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-426s1c1
Sequence:CCGGAGATCTCAAAGTGAAGCGCATCTCGAGATGCGCTTCACTTTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-405s1c1
Sequence:CCGGGTTAGCAGGTAATGCTTCCAACTCGAGTTGGAAGCATTACCTGCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126043
VALIDATED
H2AFV MISSION shRNA shRNA Plasmid DNA
H2A histone family, member V
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-397s1c1
Sequence:CCGGGTGTTGGAGTTAGCAGGTAATCTCGAGATTACCTGCTAACTCCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-354s1c1
Sequence:CCGGTGCTGTGTACAGTGCCGCAATCTCGAGATTGCGGCACTGTACACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-370s1c1
Sequence:CCGGGCAATTCTGGAGTACCTCACACTCGAGTGTGAGGTACTCCAGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-426s1c1
Sequence:CCGGAGATCTCAAAGTGAAGCGCATCTCGAGATGCGCTTCACTTTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-405s1c1
Sequence:CCGGGTTAGCAGGTAATGCTTCCAACTCGAGTTGGAAGCATTACCTGCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126043
VALIDATED
H2AFV MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member V
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-397s1c1
Sequence:CCGGGTGTTGGAGTTAGCAGGTAATCTCGAGATTACCTGCTAACTCCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-354s1c1
Sequence:CCGGTGCTGTGTACAGTGCCGCAATCTCGAGATTGCGGCACTGTACACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-370s1c1
Sequence:CCGGGCAATTCTGGAGTACCTCACACTCGAGTGTGAGGTACTCCAGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-426s1c1
Sequence:CCGGAGATCTCAAAGTGAAGCGCATCTCGAGATGCGCTTCACTTTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_126043.5-405s1c1
Sequence:CCGGGTTAGCAGGTAATGCTTCCAACTCGAGTTGGAAGCATTACCTGCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)