EMAIL THIS PAGE TO A FRIEND

H2AFX

H2A histone family, member X

90 Gene Product Result for
Synonyms: H2A.X H2A/X H2AX
UniProtKB ID: P16104, Q4ZGJ7, Q6IAS5
Gene ID:
Human(3014) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a member of the histone H2A family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif. [provided by RefSeq, Jul 2008]
Mouse(15270) H2A histone family, member X
Rat(500987) H2A histone family, member X
Zebrafish(394048) H2A histone family, member X
chicken(100857391) H2A histone family, member X
cow(531733) H2A histone family, member X
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108671 Anti-H2AFX affinity isolated antibody guinea pig, bovine, dog, human, mouse, rat
western blot pricing
SAB4300514 Anti-H2AFX (Ab-139) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101004 Anti-H2AFX antibody produced in rabbit affinity isolated antibody human, pig, bovine, guinea pig, zebrafish, horse, mouse, rat, canine
western blot pricing
HPA041189 Anti-H2AFX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA051647 Anti-H2AFX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4501368 Anti-Histone H2A.X antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB2702409 Anti-Histone H2A.X antibody produced in rabbit affinity isolated antibody zebrafish
immunohistochemistry, western blot pricing
SAB4501369 Anti-Histone H2AX  antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB4300213 Anti-phospho-H2AFX (pSer139) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4504428 Anti-phospho-Histone H2A.X (pSer139) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
H5912 Anti-phospho-Histone H2AX (pSer139) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
microarray, western blot pricing
PLA0294 Goat anti-H2AX Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, mouse
immunohistochemistry, proximity ligation assay, western blot pricing
WH0003014M5 Monoclonal Anti-H2AFX antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1403902 Monoclonal Anti-H2AFX, (N-terminal) antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
PLA0023 Rabbit anti-H2AX Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunohistochemistry, proximity ligation assay, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
CLLS1061 MCF10A CELLS H2AFX (-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002105 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-376 Anti-acetyl-Histone H2A Antibody Detect acetyl-Histone H2A also known as Histone H2A with Anti-acetyl-Histone H2A Antibody (Rabbit Polyclonal Antibody), that has been demonstrated to work in WB. pricing
07-290 Anti-acetyl-Histone H2A (Lys5) Antibody Anti-acetyl-Histone H2A (Lys5) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-Histone H2A (Lys5) also known as H2AK5Ac, Histone H2A (acetyl K5) & has been validated in WB. pricing
07-289 Anti-acetyl-Histone H2A (Lys9) Antibody Anti-acetyl-Histone H2A (Lys9) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-Histone H2A (Lys9) also known as H2AK9Ac, Histone H2A (acetyl K9) & has been validated in WB. pricing
07-627 Anti-Histone H2A.X Antibody Anti-Histone H2A.X Antibody, Cat. No. 07-627, is a highly specific rabbit polyclonal antibody that targets Histone H2A.X and has been tested for use in Immunohistochemistry (Paraffin) and Western Blotting. pricing
AB10022 Anti-Histone H2A.X Antibody Use Anti-Histone H2A.X Antibody, Human (Rabbit Polyclonal Antibody) validated in WB to detect Histone H2A.X also known as H2AFX. pricing
ABE1960 Anti-Histone H2A.X Antibody Anti-Histone H2A.X Antibody is an antibody against Histone H2A.X for use in Western Blotting, Chromatin Immunoprecipitation (ChIP), ChIP-seq. pricing
05-636-AF555 Anti-phospho-H2A.X Antibody (Ser139), clone JBW30, Alexa Fluor® 555 Conjugate Anti-phospho-H2A.X (Ser139), clone JBW30, Alexa Fluor® 555 Conjugate is an antibody against phospho-H2A.X (Ser139) for use in Immunocytochemistry. pricing
07-164-AF647 Anti-phospho H2A.X (Ser139) Antibody, Alexa Fluor® 647 Conjugate This AlexaFluor®647 conjugated Anti-phospho Histone H2A.X antibody is validated for use in mmunocytochemistry for the detection of phospho-Histone H2A.X. pricing
ABE1457 Anti-phospho-H2A.X (Tyr142) Antibody ABE1457 is an antibody against phospho-H2A.X for use in Western Blotting, Dot Blot, Immunocytochemistry. pricing
07-1590 Anti-phospho Histone H2A.X Antibody (Tyr142) Anti-phospho Histone H2A.X Antibody (Tyr142) is a highly specific rabbit polyclonal antibody, that targets Histone H2A.X & has been tested in western blotting & Dot Blot. pricing
05-636 Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301 Anti-phospho-Histone H2A.X (Ser139), clone JBW301 is a well published Mouse Monoclonal Antibody validated in ChIP, ICC, IF, WB. This purified mAb is highly specific for phospho-Histone H2A.X (Ser139) also known as H2AXS139p. pricing
05-636-I Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301 Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301 is a highly specific mouse monoclonal antibody, that targets Histone H2A.X & has been tested in western blotting, ICC, ChIP & Immunofluorescence. pricing
05-636-AF647 Anti-phospho Histone H2A.X (Ser139) Antibody, clone JBW301, Alexa Fluor® 647 This Anti-phospho Histone H2A.X (Ser139) Antibody, clone JBW301, Alexa Fluor® 647 is validated for use in ICC for the detection of phospho Histone H2A.X (Ser139). pricing
16-193 Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301, biotin conjugate Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301, biotin conjugate is a Mouse Monoclonal Antibody for detection of phospho-Histone H2A.X (Ser139) also known as H2AXS139P, H2AX histone & has been validated in ICC & WB. pricing
16-202A Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301, FITC conjugate Use Anti-phospho-Histone H2A.X (Ser139) Antibody, clone JBW301, FITC conjugate (mouse monoclonal antibody) validated in FC, ICC to detect phospho-Histone H2A.X (Ser139) also known as H2AXS139P, H2AX histone. pricing
05-636-AF488 Anti-phospho Histone H2A.X (Ser139), clone JBW301, Alexa Fluor® 488 Conjugate Antibody This Anti-phospho Histone H2A.X (Ser139) antibody, clone JBW301, Alexa Fluor® 488 Conjugate is validated for use in ICC for the detection of phospho Histone H2A.X (Ser139). pricing
MABE171 Anti-phospho-Histone H2A.X (Thr120) Antibody, clone 11F5.3 Anti-phospho-Histone H2A.X (Thr120) Antibody, clone 11F5.3 is a mouse monoclonal antibody for detection of phospho-Histone H2A.X (Thr120) also known as Histone H2A.X, H2A/X & has been validated in WB, DB. pricing
AB10029 Anti-Ubiquityl Histone H2A.X (Lys119) Antibody Anti-Ubiquityl Histone H2A.X (Lys119) Antibody is a rabbit polyclonal antibody for detection of Ubiquityl Histone H2A.X (Lys119) also known as H2AXK119Ub, Histone H2A.X Ubiquityl K119) & has been validated in WB, IP, ICC. pricing
17-344 H2A.X Phosphorylation Assay Kit (Flow Cytometry) The H2A.X Phosphorylation Assay Kit (Flow cytometry) is a cell based assay formatted for flow cytometric detection of levels of phosphorylated Histone H2A.X. pricing
14-493 Histone H2A Protein, human recombinant, 100 µg Recombinant human Histone H2A produced in E. coli, purified using FPLC. For use in Enzyme Assays. pricing
14-409 Histone H2A, Recombinant Xenopus laevis Recombinant Xenopus laevis Histone H2A. pricing
14-576 Histone H2A.X Protein, human recombinant, 100 µg Recombinant human Histone H2A.X for use as a substrate in in vitro enzymatic reactions, such as phosphorylation at Ser139 by Rsk1 or MSK1. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002105 Rosetta Predictions human pricing
NM_001109291 Rosetta Predictions rat pricing
NM_010436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021350 predicted 210
2 SASI_Hs01_00021351 predicted 584
3 SASI_Hs02_00333218 predicted 1429
4 SASI_Hs01_00021353 predicted 1509
5 SASI_Hs01_00021354 predicted 1056
6 SASI_Hs01_00021355 predicted 1456
7 SASI_Hs01_00021357 predicted 1450
8 SASI_Hs02_00333219 predicted 1221
9 SASI_Hs01_00021358 predicted 1522
10 SASI_Hs01_00021359 predicted 1441
11 SASI_Hs01_00021352 predicted 182
12 SASI_Hs01_00021356 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246974 predicted 604
2 SASI_Rn02_00246975 predicted 331
3 SASI_Rn02_00246976 predicted 246
4 SASI_Rn02_00246977 predicted 535
5 SASI_Rn02_00246978 predicted 538
6 SASI_Rn02_00246979 predicted 533
7 SASI_Rn02_00246980 predicted 251
8 SASI_Rn02_00246981 predicted 900
9 SASI_Rn02_00246982 predicted 928
10 SASI_Rn02_00246983 predicted 98
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153804 predicted 856
2 SASI_Mm01_00153805 predicted 837
3 SASI_Mm01_00153806 predicted 950
4 SASI_Mm01_00153807 predicted 908
5 SASI_Mm01_00153809 predicted 938
6 SASI_Mm01_00153811 predicted 735
7 SASI_Mm01_00153810 predicted 965
8 SASI_Mm01_00153808 predicted 941
9 SASI_Mm01_00153812 predicted 94
10 SASI_Mm02_00318591 predicted 857
11 SASI_Mm01_00153813 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002105
VALIDATED
H2AFX MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member X
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-292s1c1
Sequence:CCGGCAACAAGAAGACGCGAATCATCTCGAGATGATTCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002105.2-397s1c1
Sequence:CCGGCCTGCCCAACATCCAGGCCGTCTCGAGACGGCCTGGATGTTGGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-484s1c1
Sequence:CCGGCCAGGCCTCCCAGGAGTACTACTCGAGTAGTACTCCTGGGAGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002105.2-1485s1c1
Sequence:CCGGCGTTGGCTTCTGAACTGGAATCTCGAGATTCCAGTTCAGAAGCCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-486s21c1
Sequence:CCGGAGGCCTCCCAGGAGTACTAAGCTCGAGCTTAGTACTCCTGGGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-417s21c1
Sequence:CCGGTGCTGCTGCCCAAGAAGACCACTCGAGTGGTCTTCTTGGGCAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-289s1c1
Sequence:CCGGCGACAACAAGAAGACGCGAATCTCGAGATTCGCGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-429s21c1
Sequence:CCGGAGAAGACCAGCGCCACCGTGGCTCGAGCCACGGTGGCGCTGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-340s21c1
Sequence:CCGGCAACGACGAGGAGCTCAACAACTCGAGTTGTTGAGCTCCTCGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-241s21c1
Sequence:CCGGGGAGTACCTCACCGCTGAGATCTCGAGATCTCAGCGGTGAGGTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002105.2-542s21c1
Sequence:CCGGATGCCACCACAAAGGCCCTTTCTCGAGAAAGGGCCTTTGTGGTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002105
VALIDATED
H2AFX MISSION shRNA shRNA Plasmid DNA
H2A histone family, member X
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-292s1c1
Sequence:CCGGCAACAAGAAGACGCGAATCATCTCGAGATGATTCGCGTCTTCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002105.2-397s1c1
Sequence:CCGGCCTGCCCAACATCCAGGCCGTCTCGAGACGGCCTGGATGTTGGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-484s1c1
Sequence:CCGGCCAGGCCTCCCAGGAGTACTACTCGAGTAGTACTCCTGGGAGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002105.2-1485s1c1
Sequence:CCGGCGTTGGCTTCTGAACTGGAATCTCGAGATTCCAGTTCAGAAGCCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-486s21c1
Sequence:CCGGAGGCCTCCCAGGAGTACTAAGCTCGAGCTTAGTACTCCTGGGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-417s21c1
Sequence:CCGGTGCTGCTGCCCAAGAAGACCACTCGAGTGGTCTTCTTGGGCAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-289s1c1
Sequence:CCGGCGACAACAAGAAGACGCGAATCTCGAGATTCGCGTCTTCTTGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-429s21c1
Sequence:CCGGAGAAGACCAGCGCCACCGTGGCTCGAGCCACGGTGGCGCTGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-340s21c1
Sequence:CCGGCAACGACGAGGAGCTCAACAACTCGAGTTGTTGAGCTCCTCGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-241s21c1
Sequence:CCGGGGAGTACCTCACCGCTGAGATCTCGAGATCTCAGCGGTGAGGTACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002105.2-542s21c1
Sequence:CCGGATGCCACCACAAAGGCCCTTTCTCGAGAAAGGGCCTTTGTGGTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002105
VALIDATED
H2AFX MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member X
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-292s1c1
Sequence:CCGGCAACAAGAAGACGCGAATCATCTCGAGATGATTCGCGTCTTCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002105.2-397s1c1
Sequence:CCGGCCTGCCCAACATCCAGGCCGTCTCGAGACGGCCTGGATGTTGGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-484s1c1
Sequence:CCGGCCAGGCCTCCCAGGAGTACTACTCGAGTAGTACTCCTGGGAGGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002105.2-1485s1c1
Sequence:CCGGCGTTGGCTTCTGAACTGGAATCTCGAGATTCCAGTTCAGAAGCCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-486s21c1
Sequence:CCGGAGGCCTCCCAGGAGTACTAAGCTCGAGCTTAGTACTCCTGGGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-417s21c1
Sequence:CCGGTGCTGCTGCCCAAGAAGACCACTCGAGTGGTCTTCTTGGGCAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002105.2-289s1c1
Sequence:CCGGCGACAACAAGAAGACGCGAATCTCGAGATTCGCGTCTTCTTGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-429s21c1
Sequence:CCGGAGAAGACCAGCGCCACCGTGGCTCGAGCCACGGTGGCGCTGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-340s21c1
Sequence:CCGGCAACGACGAGGAGCTCAACAACTCGAGTTGTTGAGCTCCTCGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002105.2-241s21c1
Sequence:CCGGGGAGTACCTCACCGCTGAGATCTCGAGATCTCAGCGGTGAGGTACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002105.2-542s21c1
Sequence:CCGGATGCCACCACAAAGGCCCTTTCTCGAGAAAGGGCCTTTGTGGTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010436
VALIDATED
H2AFX MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member X
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-215s21c1
Sequence:CCGGCGAGTACCTCACTGCCGAGATCTCGAGATCTCGGCAGTGAGGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-1184s1c1
Sequence:CCGGGCGACTCAACTACAACCCAAACTCGAGTTTGGGTTGTAGTTGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-215s1c1
Sequence:CCGGCGAGTACCTCACTGCCGAGATCTCGAGATCTCGGCAGTGAGGTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-152s1c1
Sequence:CCGGGCGGAAAGGCCACTACGCCGACTCGAGTCGGCGTAGTGGCCTTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-85s1c1
Sequence:CCGGCCAAGGCCAAGTCGCGCTCTTCTCGAGAAGAGCGCGACTTGGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-212s1c1
Sequence:CCGGGCTCGAGTACCTCACTGCCGACTCGAGTCGGCAGTGAGGTACTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-85s21c1
Sequence:CCGGCCAAGGCCAAGTCGCGCTCTTCTCGAGAAGAGCGCGACTTGGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-978s21c1
Sequence:CCGGTGCTGGCCTCATACCAGTTGACTCGAGTCAACTGGTATGAGGCCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-942s21c1
Sequence:CCGGAGAAATGGATCACATTGTTTCCTCGAGGAAACAATGTGATCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-865s21c1
Sequence:CCGGGCGTCTTTGCTTCAGCTTGGTCTCGAGACCAAGCTGAAGCAAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010436
VALIDATED
H2AFX MISSION shRNA shRNA Plasmid DNA
H2A histone family, member X
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-215s21c1
Sequence:CCGGCGAGTACCTCACTGCCGAGATCTCGAGATCTCGGCAGTGAGGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-1184s1c1
Sequence:CCGGGCGACTCAACTACAACCCAAACTCGAGTTTGGGTTGTAGTTGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-215s1c1
Sequence:CCGGCGAGTACCTCACTGCCGAGATCTCGAGATCTCGGCAGTGAGGTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-152s1c1
Sequence:CCGGGCGGAAAGGCCACTACGCCGACTCGAGTCGGCGTAGTGGCCTTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-85s1c1
Sequence:CCGGCCAAGGCCAAGTCGCGCTCTTCTCGAGAAGAGCGCGACTTGGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-212s1c1
Sequence:CCGGGCTCGAGTACCTCACTGCCGACTCGAGTCGGCAGTGAGGTACTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-85s21c1
Sequence:CCGGCCAAGGCCAAGTCGCGCTCTTCTCGAGAAGAGCGCGACTTGGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-978s21c1
Sequence:CCGGTGCTGGCCTCATACCAGTTGACTCGAGTCAACTGGTATGAGGCCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-942s21c1
Sequence:CCGGAGAAATGGATCACATTGTTTCCTCGAGGAAACAATGTGATCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-865s21c1
Sequence:CCGGGCGTCTTTGCTTCAGCTTGGTCTCGAGACCAAGCTGAAGCAAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010436
VALIDATED
H2AFX MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member X
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-215s21c1
Sequence:CCGGCGAGTACCTCACTGCCGAGATCTCGAGATCTCGGCAGTGAGGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-1184s1c1
Sequence:CCGGGCGACTCAACTACAACCCAAACTCGAGTTTGGGTTGTAGTTGAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-215s1c1
Sequence:CCGGCGAGTACCTCACTGCCGAGATCTCGAGATCTCGGCAGTGAGGTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-152s1c1
Sequence:CCGGGCGGAAAGGCCACTACGCCGACTCGAGTCGGCGTAGTGGCCTTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-85s1c1
Sequence:CCGGCCAAGGCCAAGTCGCGCTCTTCTCGAGAAGAGCGCGACTTGGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010436.2-212s1c1
Sequence:CCGGGCTCGAGTACCTCACTGCCGACTCGAGTCGGCAGTGAGGTACTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-85s21c1
Sequence:CCGGCCAAGGCCAAGTCGCGCTCTTCTCGAGAAGAGCGCGACTTGGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-978s21c1
Sequence:CCGGTGCTGGCCTCATACCAGTTGACTCGAGTCAACTGGTATGAGGCCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348562    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-942s21c1
Sequence:CCGGAGAAATGGATCACATTGTTTCCTCGAGGAAACAATGTGATCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010436.2-865s21c1
Sequence:CCGGGCGTCTTTGCTTCAGCTTGGTCTCGAGACCAAGCTGAAGCAAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)