EMAIL THIS PAGE TO A FRIEND

H2AFY2

H2A histone family, member Y2

93 Gene Product Result for
Synonyms: macroH2A2
UniProtKB ID: Q9P0M6, Q5SQT2
Gene ID:
Mouse(404634) H2A histone family, member Y2
Rat(361844) H2A histone family, member Y2
Zebrafish(558711) H2A histone family, member Y2
cow(537167) H2A histone family, member Y2
dog(489024) H2A histone family, member Y2
chicken(423721) H2A histone family, member Y2
Domestic Rabbit(100343925) H2A histone family, member Y2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018649 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018649 Rosetta Predictions human pricing
XM_001056152 Rosetta Predictions rat pricing
XM_001056275 Rosetta Predictions rat pricing
XM_001056330 Rosetta Predictions rat pricing
XM_001056397 Rosetta Predictions rat pricing
XM_342138 Rosetta Predictions rat pricing
NM_207000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013231 predicted 1323
2 SASI_Hs01_00013232 predicted 911
3 SASI_Hs01_00013233 predicted 1124
4 SASI_Hs01_00013234 predicted 1407
5 SASI_Hs01_00013236 predicted 1119
6 SASI_Hs01_00013237 predicted 1125
7 SASI_Hs01_00013238 predicted 588
8 SASI_Hs01_00013239 predicted 1167
9 SASI_Hs01_00013240 predicted 1568
10 SASI_Hs02_00352147 predicted 998
11 SASI_Hs01_00013235 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282244 predicted 742
2 SASI_Rn02_00282245 predicted 766
3 SASI_Rn02_00282246 predicted 783
4 SASI_Rn02_00282247 predicted 696
5 SASI_Rn02_00282248 predicted 966
6 SASI_Rn02_00282249 predicted 966
7 SASI_Rn02_00282250 predicted 1039
8 SASI_Rn02_00282251 predicted 962
9 SASI_Rn02_00282252 predicted 922
10 SASI_Rn02_00282253 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282745 predicted 699
2 SASI_Rn02_00282746 predicted 480
3 SASI_Rn02_00282747 predicted 468
4 SASI_Rn02_00282748 predicted 834
5 SASI_Rn02_00282749 predicted 689
6 SASI_Rn02_00282750 predicted 227
7 SASI_Rn02_00282751 predicted 740
8 SASI_Rn02_00282752 predicted 473
9 SASI_Rn02_00282753 predicted 302
10 SASI_Rn02_00282754 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00282930 predicted 773
2 SASI_Rn02_00282931 predicted 555
3 SASI_Rn02_00282932 predicted 246
4 SASI_Rn02_00282933 predicted 283
5 SASI_Rn02_00282934 predicted 817
6 SASI_Rn02_00282935 predicted 545
7 SASI_Rn02_00282936 predicted 361
8 SASI_Rn02_00282937 predicted 539
9 SASI_Rn02_00282938 predicted 731
10 SASI_Rn02_00282939 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056397 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00283133 predicted 778
2 SASI_Rn02_00283134 predicted 560
3 SASI_Rn02_00283135 predicted 546
4 SASI_Rn02_00283136 predicted 244
5 SASI_Rn02_00283137 predicted 290
6 SASI_Rn02_00283138 predicted 825
7 SASI_Rn02_00283139 predicted 556
8 SASI_Rn02_00283140 predicted 364
9 SASI_Rn02_00283141 predicted 739
10 SASI_Rn02_00283142 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393804 predicted 1162
2 SASI_Rn02_00393805 predicted 936
3 SASI_Rn02_00393806 predicted 929
4 SASI_Rn02_00393807 predicted 620
5 SASI_Rn02_00393808 predicted 665
6 SASI_Rn02_00393809 predicted 1206
7 SASI_Rn02_00393810 predicted 932
8 SASI_Rn02_00393811 predicted 738
9 SASI_Rn02_00393812 predicted 1108
10 SASI_Rn02_00393813 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031893 predicted 477
2 SASI_Mm01_00031894 predicted 1252
3 SASI_Mm01_00031895 predicted 323
4 SASI_Mm01_00031896 predicted 979
5 SASI_Mm01_00031897 predicted 1633
6 SASI_Mm01_00031898 predicted 1638
7 SASI_Mm01_00031899 predicted 862
8 SASI_Mm01_00031900 predicted 1648
9 SASI_Mm01_00031901 predicted 1673
10 SASI_Mm01_00031902 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018649
VALIDATED
H2AFY2 MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member Y2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-1473s1c1
Sequence:CCGGCCCTTCACACTCTCCTCCAAACTCGAGTTTGGAGGAGAGTGTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-871s1c1
Sequence:CCGGACAGCCGAAATTGACCTCAAACTCGAGTTTGAGGTCAATTTCGGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018649.1-704s1c1
Sequence:CCGGACAGCGATAAAGAAGGAACTTCTCGAGAAGTTCCTTCTTTATCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-692s1c1
Sequence:CCGGCCAAACCAAAGGACAGCGATACTCGAGTATCGCTGTCCTTTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1061s21c1
Sequence:CCGGAGAGTGACATCAGCCATATTGCTCGAGCAATATGGCTGATGTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018649.2-1741s21c1
Sequence:CCGGGAGCCTCCATCTGTAAGGAAGCTCGAGCTTCCTTACAGATGGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-938s21c1
Sequence:CCGGCCAAACCAAAGGACAGCGATACTCGAGTATCGCTGTCCTTTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1120s21c1
Sequence:CCGGGCCGAAATTGACCTCAAAGAACTCGAGTTCTTTGAGGTCAATTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018649.2-1902s21c1
Sequence:CCGGTAAATCTTCTGTTCCTCCTTTCTCGAGAAAGGAGGAACAGAAGATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1177s21c1
Sequence:CCGGGAGTTCTTGGAAACGGTAAAGCTCGAGCTTTACCGTTTCCAAGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018649
VALIDATED
H2AFY2 MISSION shRNA shRNA Plasmid DNA
H2A histone family, member Y2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-1473s1c1
Sequence:CCGGCCCTTCACACTCTCCTCCAAACTCGAGTTTGGAGGAGAGTGTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-871s1c1
Sequence:CCGGACAGCCGAAATTGACCTCAAACTCGAGTTTGAGGTCAATTTCGGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018649.1-704s1c1
Sequence:CCGGACAGCGATAAAGAAGGAACTTCTCGAGAAGTTCCTTCTTTATCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-692s1c1
Sequence:CCGGCCAAACCAAAGGACAGCGATACTCGAGTATCGCTGTCCTTTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1061s21c1
Sequence:CCGGAGAGTGACATCAGCCATATTGCTCGAGCAATATGGCTGATGTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018649.2-1741s21c1
Sequence:CCGGGAGCCTCCATCTGTAAGGAAGCTCGAGCTTCCTTACAGATGGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-938s21c1
Sequence:CCGGCCAAACCAAAGGACAGCGATACTCGAGTATCGCTGTCCTTTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1120s21c1
Sequence:CCGGGCCGAAATTGACCTCAAAGAACTCGAGTTCTTTGAGGTCAATTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018649.2-1902s21c1
Sequence:CCGGTAAATCTTCTGTTCCTCCTTTCTCGAGAAAGGAGGAACAGAAGATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1177s21c1
Sequence:CCGGGAGTTCTTGGAAACGGTAAAGCTCGAGCTTTACCGTTTCCAAGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018649
VALIDATED
H2AFY2 MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member Y2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106905    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-1473s1c1
Sequence:CCGGCCCTTCACACTCTCCTCCAAACTCGAGTTTGGAGGAGAGTGTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-871s1c1
Sequence:CCGGACAGCCGAAATTGACCTCAAACTCGAGTTTGAGGTCAATTTCGGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018649.1-704s1c1
Sequence:CCGGACAGCGATAAAGAAGGAACTTCTCGAGAAGTTCCTTCTTTATCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018649.1-692s1c1
Sequence:CCGGCCAAACCAAAGGACAGCGATACTCGAGTATCGCTGTCCTTTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1061s21c1
Sequence:CCGGAGAGTGACATCAGCCATATTGCTCGAGCAATATGGCTGATGTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018649.2-1741s21c1
Sequence:CCGGGAGCCTCCATCTGTAAGGAAGCTCGAGCTTCCTTACAGATGGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-938s21c1
Sequence:CCGGCCAAACCAAAGGACAGCGATACTCGAGTATCGCTGTCCTTTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1120s21c1
Sequence:CCGGGCCGAAATTGACCTCAAAGAACTCGAGTTCTTTGAGGTCAATTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018649.2-1902s21c1
Sequence:CCGGTAAATCTTCTGTTCCTCCTTTCTCGAGAAAGGAGGAACAGAAGATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018649.2-1177s21c1
Sequence:CCGGGAGTTCTTGGAAACGGTAAAGCTCGAGCTTTACCGTTTCCAAGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207000
H2AFY2 MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member Y2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000096924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207000.1-1635s1c1
Sequence:CCGGGTTCACAGTTTCTGTGTCTTTCTCGAGAAAGACACAGAAACTGTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-420s1c1
Sequence:CCGGGCTACTGAAAGGAGTGACTATCTCGAGATAGTCACTCCTTTCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-741s1c1
Sequence:CCGGCCAGAGTGACATCAGCCATATCTCGAGATATGGCTGATGTCACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-635s1c1
Sequence:CCGGGCGATAAAGAAGGAACATCAACTCGAGTTGATGTTCCTTCTTTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207000
H2AFY2 MISSION shRNA shRNA Plasmid DNA
H2A histone family, member Y2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000096924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207000.1-1635s1c1
Sequence:CCGGGTTCACAGTTTCTGTGTCTTTCTCGAGAAAGACACAGAAACTGTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-420s1c1
Sequence:CCGGGCTACTGAAAGGAGTGACTATCTCGAGATAGTCACTCCTTTCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-741s1c1
Sequence:CCGGCCAGAGTGACATCAGCCATATCTCGAGATATGGCTGATGTCACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-635s1c1
Sequence:CCGGGCGATAAAGAAGGAACATCAACTCGAGTTGATGTTCCTTCTTTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207000
H2AFY2 MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member Y2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000096924    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207000.1-1635s1c1
Sequence:CCGGGTTCACAGTTTCTGTGTCTTTCTCGAGAAAGACACAGAAACTGTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-420s1c1
Sequence:CCGGGCTACTGAAAGGAGTGACTATCTCGAGATAGTCACTCCTTTCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-741s1c1
Sequence:CCGGCCAGAGTGACATCAGCCATATCTCGAGATATGGCTGATGTCACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207000.1-635s1c1
Sequence:CCGGGCGATAAAGAAGGAACATCAACTCGAGTTGATGTTCCTTCTTTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)