EMAIL THIS PAGE TO A FRIEND

H2AFY

H2A histone family, member Y

141 Gene Product Result for
Synonyms: H2A.y H2A/y H2AF12M H2AFJ MACROH2A1.1 mH2A1 macroH2A1.2
Gene ID:
Human(9555) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(26914) H2A histone family, member Y
Rat(29384) H2A histone family, member Y
Zebrafish(678613) H2A histone family, member Y
cow(532990) H2A histone family, member Y
Horse(100062747) H2A histone family, member Y
dog(481514) H2A histone family, member Y
chicken(395858) H2A histone family, member Y
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU098621 MISSION® esiRNA esiRNA human H2AFY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040158 Rosetta Predictions human pricing
NM_004893 Rosetta Predictions human pricing
NM_138609 Rosetta Predictions human pricing
NM_138610 Rosetta Predictions human pricing
NM_017182 Rosetta Predictions rat pricing
NM_012015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308863 predicted 1674
2 SASI_Hs01_00033959 predicted 396
3 SASI_Hs01_00033960 predicted 1093
4 SASI_Hs01_00033961 predicted 448
5 SASI_Hs01_00033962 predicted 1605
6 SASI_Hs02_00308864 predicted 395
7 SASI_Hs01_00033963 predicted 402
8 SASI_Hs01_00033964 predicted 1093
9 SASI_Hs01_00033965 predicted 1115
10 SASI_Hs01_00033966 predicted 1604
11 SASI_Hs01_00033967 predicted 402
12 SASI_Hs01_00033968 predicted 1695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338530 predicted 1637
2 SASI_Hs01_00203361 predicted 362
3 SASI_Hs01_00203362 predicted 1056
4 SASI_Hs01_00203363 predicted 411
5 SASI_Hs01_00203364 predicted 1565
6 SASI_Hs02_00338531 predicted 357
7 SASI_Hs01_00203365 predicted 360
8 SASI_Hs01_00203366 predicted 1054
9 SASI_Hs01_00203367 predicted 1083
10 SASI_Hs01_00203368 predicted 1562
11 SASI_Hs01_00203369 predicted 367
12 SASI_Hs01_00203370 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138609 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363734 predicted 1666
2 SASI_Hs01_00206822 predicted 394
3 SASI_Hs01_00206823 predicted 1082
4 SASI_Hs01_00206824 predicted 452
5 SASI_Hs01_00206825 predicted 1600
6 SASI_Hs02_00363735 predicted 400
7 SASI_Hs01_00206826 predicted 401
8 SASI_Hs01_00206827 predicted 1085
9 SASI_Hs01_00206828 predicted 1115
10 SASI_Hs01_00206829 predicted 1595
11 SASI_Hs01_00206830 predicted 403
12 SASI_Hs01_00206831 predicted 1689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363736 predicted 1680
2 SASI_Hs01_00055132 predicted 397
3 SASI_Hs01_00055133 predicted 1096
4 SASI_Hs01_00055134 predicted 447
5 SASI_Hs01_00055135 predicted 1606
6 SASI_Hs02_00363737 predicted 399
7 SASI_Hs01_00055136 predicted 400
8 SASI_Hs01_00055137 predicted 1097
9 SASI_Hs01_00055138 predicted 1117
10 SASI_Hs01_00055139 predicted 1605
11 SASI_Hs01_00055140 predicted 394
12 SASI_Hs01_00055141 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063315 predicted 287
2 SASI_Rn01_00063316 predicted 440
3 SASI_Rn01_00063317 predicted 725
4 SASI_Rn01_00063318 predicted 1027
5 SASI_Rn01_00063319 predicted 814
6 SASI_Rn01_00063320 predicted 448
7 SASI_Rn01_00063321 predicted 836
8 SASI_Rn02_00261517 predicted 838
9 SASI_Rn02_00261518 predicted 830
10 SASI_Rn01_00063322 predicted 650
11 SASI_Rn01_00063323 predicted 783
12 SASI_Rn01_00063324 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033048 predicted 317
2 SASI_Mm01_00033049 predicted 476
3 SASI_Mm02_00321957 predicted 940
4 SASI_Mm01_00033050 predicted 486
5 SASI_Mm01_00033051 predicted 854
6 SASI_Mm01_00033052 predicted 871
7 SASI_Mm01_00033053 predicted 883
8 SASI_Mm02_00321958 predicted 876
9 SASI_Mm02_00321959 predicted 802
10 SASI_Mm01_00033055 predicted 864
11 SASI_Mm01_00033054 predicted 1070
12 SASI_Mm01_00033056 predicted 1027
13 SASI_Mm01_00033057 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138610
VALIDATED
H2AFY MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member Y
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-370s21c1
Sequence:CCGGGAATACCTGACAGCGGAGATTCTCGAGAATCTCCGCTGTCAGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-1022s21c1
Sequence:CCGGAGTTTGTGATCCACTGTAATACTCGAGTATTACAGTGGATCACAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-631s21c1
Sequence:CCGGCAGAAGAAGCCTGTATCTAAACTCGAGTTTAGATACAGGCTTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-575s21c1
Sequence:CCGGGAAAGTTGGAAGCCATCATCACTCGAGTGATGATGGCTTCCAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-846s1c1
Sequence:CCGGGCTGACATTGACCTTAAAGATCTCGAGATCTTTAAGGTCAATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-441s1c1
Sequence:CCGGGCCAATGATGAAGAGCTGAATCTCGAGATTCAGCTCTTCATCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-774s1c1
Sequence:CCGGCTGAACCTTATTCACAGTGAACTCGAGTTCACTGTGAATAAGGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-1659s1c1
Sequence:CCGGGCGTGTGTTGTGGTGCTTTATCTCGAGATAAAGCACCACAACACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-1189s1c1
Sequence:CCGGCCAGTTACTTCGTGTCTACAACTCGAGTTGTAGACACGAAGTAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138610
VALIDATED
H2AFY MISSION shRNA shRNA Plasmid DNA
H2A histone family, member Y
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-370s21c1
Sequence:CCGGGAATACCTGACAGCGGAGATTCTCGAGAATCTCCGCTGTCAGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-1022s21c1
Sequence:CCGGAGTTTGTGATCCACTGTAATACTCGAGTATTACAGTGGATCACAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-631s21c1
Sequence:CCGGCAGAAGAAGCCTGTATCTAAACTCGAGTTTAGATACAGGCTTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-575s21c1
Sequence:CCGGGAAAGTTGGAAGCCATCATCACTCGAGTGATGATGGCTTCCAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-846s1c1
Sequence:CCGGGCTGACATTGACCTTAAAGATCTCGAGATCTTTAAGGTCAATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-441s1c1
Sequence:CCGGGCCAATGATGAAGAGCTGAATCTCGAGATTCAGCTCTTCATCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-774s1c1
Sequence:CCGGCTGAACCTTATTCACAGTGAACTCGAGTTCACTGTGAATAAGGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-1659s1c1
Sequence:CCGGGCGTGTGTTGTGGTGCTTTATCTCGAGATAAAGCACCACAACACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-1189s1c1
Sequence:CCGGCCAGTTACTTCGTGTCTACAACTCGAGTTGTAGACACGAAGTAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138610
VALIDATED
H2AFY MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member Y
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-370s21c1
Sequence:CCGGGAATACCTGACAGCGGAGATTCTCGAGAATCTCCGCTGTCAGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-1022s21c1
Sequence:CCGGAGTTTGTGATCCACTGTAATACTCGAGTATTACAGTGGATCACAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-631s21c1
Sequence:CCGGCAGAAGAAGCCTGTATCTAAACTCGAGTTTAGATACAGGCTTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138610.2-575s21c1
Sequence:CCGGGAAAGTTGGAAGCCATCATCACTCGAGTGATGATGGCTTCCAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-846s1c1
Sequence:CCGGGCTGACATTGACCTTAAAGATCTCGAGATCTTTAAGGTCAATGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-441s1c1
Sequence:CCGGGCCAATGATGAAGAGCTGAATCTCGAGATTCAGCTCTTCATCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-774s1c1
Sequence:CCGGCTGAACCTTATTCACAGTGAACTCGAGTTCACTGTGAATAAGGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-1659s1c1
Sequence:CCGGGCGTGTGTTGTGGTGCTTTATCTCGAGATAAAGCACCACAACACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138610.1-1189s1c1
Sequence:CCGGCCAGTTACTTCGTGTCTACAACTCGAGTTGTAGACACGAAGTAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012015
VALIDATED
H2AFY MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member Y
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012015.1-688s21c2
Sequence:CCGGTCTAAGAAGAAGCAGGGAGAACTCGAGTTCTCCCTGCTTCTTCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-984s21c1
Sequence:CCGGGGTAGCTGGAGCTGCTATTAGCTCGAGCTAATAGCAGCTCCAGCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-1028s21c1
Sequence:CCGGAGTTTGTGATCCACTGTAATACTCGAGTATTACAGTGGATCACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-856s21c1
Sequence:CCGGGCCATAATCAATCCTACCAATCTCGAGATTGGTAGGATTGATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.2-1051s21c1
Sequence:CCGGGTTTGTGATCCACTGTAATAGCTCGAGCTATTACAGTGGATCACAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-534s21c2
Sequence:CCGGGCCGAATATCCATCCTGAGTTCTCGAGAACTCAGGATGGATATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-856s1c1
Sequence:CCGGGCCATAATCAATCCTACCAATCTCGAGATTGGTAGGATTGATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-534s1c1
Sequence:CCGGGCCGAATATCCATCCTGAGTTCTCGAGAACTCAGGATGGATATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-309s1c1
Sequence:CCGGCATCAAGAAAGGCCACCCTAACTCGAGTTAGGGTGGCCTTTCTTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-688s1c1
Sequence:CCGGTCTAAGAAGAAGCAGGGAGAACTCGAGTTCTCCCTGCTTCTTCTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-1221s1c1
Sequence:CCGGCAGCTACTTTGTCTCCACGATCTCGAGATCGTGGAGACAAAGTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012015
VALIDATED
H2AFY MISSION shRNA shRNA Plasmid DNA
H2A histone family, member Y
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012015.1-688s21c2
Sequence:CCGGTCTAAGAAGAAGCAGGGAGAACTCGAGTTCTCCCTGCTTCTTCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-984s21c1
Sequence:CCGGGGTAGCTGGAGCTGCTATTAGCTCGAGCTAATAGCAGCTCCAGCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-1028s21c1
Sequence:CCGGAGTTTGTGATCCACTGTAATACTCGAGTATTACAGTGGATCACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-856s21c1
Sequence:CCGGGCCATAATCAATCCTACCAATCTCGAGATTGGTAGGATTGATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.2-1051s21c1
Sequence:CCGGGTTTGTGATCCACTGTAATAGCTCGAGCTATTACAGTGGATCACAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-534s21c2
Sequence:CCGGGCCGAATATCCATCCTGAGTTCTCGAGAACTCAGGATGGATATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-856s1c1
Sequence:CCGGGCCATAATCAATCCTACCAATCTCGAGATTGGTAGGATTGATTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-534s1c1
Sequence:CCGGGCCGAATATCCATCCTGAGTTCTCGAGAACTCAGGATGGATATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-309s1c1
Sequence:CCGGCATCAAGAAAGGCCACCCTAACTCGAGTTAGGGTGGCCTTTCTTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-688s1c1
Sequence:CCGGTCTAAGAAGAAGCAGGGAGAACTCGAGTTCTCCCTGCTTCTTCTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-1221s1c1
Sequence:CCGGCAGCTACTTTGTCTCCACGATCTCGAGATCGTGGAGACAAAGTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012015
VALIDATED
H2AFY MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member Y
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012015.1-688s21c2
Sequence:CCGGTCTAAGAAGAAGCAGGGAGAACTCGAGTTCTCCCTGCTTCTTCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-984s21c1
Sequence:CCGGGGTAGCTGGAGCTGCTATTAGCTCGAGCTAATAGCAGCTCCAGCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-1028s21c1
Sequence:CCGGAGTTTGTGATCCACTGTAATACTCGAGTATTACAGTGGATCACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-856s21c1
Sequence:CCGGGCCATAATCAATCCTACCAATCTCGAGATTGGTAGGATTGATTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.2-1051s21c1
Sequence:CCGGGTTTGTGATCCACTGTAATAGCTCGAGCTATTACAGTGGATCACAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012015.1-534s21c2
Sequence:CCGGGCCGAATATCCATCCTGAGTTCTCGAGAACTCAGGATGGATATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-856s1c1
Sequence:CCGGGCCATAATCAATCCTACCAATCTCGAGATTGGTAGGATTGATTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-534s1c1
Sequence:CCGGGCCGAATATCCATCCTGAGTTCTCGAGAACTCAGGATGGATATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-309s1c1
Sequence:CCGGCATCAAGAAAGGCCACCCTAACTCGAGTTAGGGTGGCCTTTCTTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-688s1c1
Sequence:CCGGTCTAAGAAGAAGCAGGGAGAACTCGAGTTCTCCCTGCTTCTTCTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012015.1-1221s1c1
Sequence:CCGGCAGCTACTTTGTCTCCACGATCTCGAGATCGTGGAGACAAAGTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)