EMAIL THIS PAGE TO A FRIEND

H2AFZ

H2A histone family, member Z

122 Gene Product Result for
Synonyms: H2A.Z-1 H2A.z H2A/z H2AZ
UniProtKB ID: P0C0S5, B2RD56, P17317, Q6I9U0
Gene ID:
Human(3015) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent member of the histone H2A family that is distinct from other members of the family. Studies in mice have shown that this particular histone is required for embryonic development and indicate that lack of functional histone H2A leads to embryonic lethality. [provided by RefSeq, Jul 2008]
Mouse(51788) H2A histone family, member Z
Rat(58940) H2A histone family, member Z
sheep(443235) histone H2A.Z
Zebrafish(573415) H2A histone family, member Z
chicken(426361) H2A histone family, member Z
cow(287016) H2A histone family, member Z
dog(478493) H2A histone family, member Z
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-719 Anti-acetyl-H2A.Z (Lys14) Antibody Anti-acetyl-H2A.Z (Lys14) Antibody is a Rabbit Polyclonal Antibody for detection of acetyl-H2A.Z (Lys14) also known as H2AZ histone, histone H2A.Z, Htz1 & has been validated in WB. pricing
ABE1363 Anti-acetyl Histone H2A.Z (Lys 5, 7, 11) Antibody This Anti-acetyl Histone H2A.Z (Lys 5, 7, 11) Antibody is validated for use in Western Blotting and Immunocytochemistry and Chromatin Immunoprecipitation (ChIP) and ChIP-seq and Dot Blot and ELISA for the detection of acetyl Histone H2A.Z (Lys 5, 7, 11). pricing
MABE368 Anti-acetyl Histone H2A.Z (Lys4/7/11) Antibody, clone 299/39 Anti-acetyl Histone H2A.Z (Lys4/7/11) Antibody, clone 299/39 is a highly specific mouse monoclonal antibody, that targets Histone H2A.Z & has been tested in western blotting & Dot Blot. pricing
07-594 Anti-Histone H2A.Z Antibody Detect Histone H2A.Z also known as H2AZ histone with Anti-Histone H2A.Z Antibody (Rabbit Polyclonal Antibody), that has been demonstrated to work in WB. pricing
09-862 Anti-Histone H2A.Z Antibody Use Anti-Histone H2A.Z Antibody (Sheep Polyclonal Antibody) validated in WB to detect Histone H2A.Z also known as H2A histone family member Z, H2AZ histone. pricing
ABE1348 Anti-Histone H2A.Z Antibody (C-term) This Anti-Histone H2A.Z Antibody (C-term) is validated for use in Western Blotting and Chromatin Immunoprecipitation (ChIP) and ChIP-seq and Immunocytochemistry and ELISA for the detection of Histone H2A.Z (C-term). pricing
ABE1062 Anti-monomethyl Histone H2A.Z Antibody (Lys 7) Anti-monomethyl Histone H2A.Z (Lys 7) is an antibody against monomethyl Histone H2A.Z (Lys 7) for use in WB, ICC, DB, IP. pricing
17-10048 ChIPAb+ Histone H2A.Z - ChIP Validated Antibody and Primer Set This ChIPAb+ Histone H2A.Z -ChIP Validated Antibody & Primer Set conveniently includes the antibody & the specific control PCR primers. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002106 Rosetta Predictions human pricing
NM_022674 Rosetta Predictions rat pricing
NM_016750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240102 predicted 358
2 SASI_Hs01_00240103 predicted 273
3 SASI_Hs01_00240104 predicted 593
4 SASI_Hs01_00240105 predicted 549
5 SASI_Hs01_00240106 predicted 228
6 SASI_Hs01_00240107 predicted 464
7 SASI_Hs01_00240108 predicted 199
8 SASI_Hs01_00240109 predicted 401
9 SASI_Hs01_00240110 predicted 265
10 SASI_Hs02_00333220 predicted 582
11 SASI_Hs01_00240111 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102976 predicted 440
2 SASI_Rn01_00102977 predicted 321
3 SASI_Rn01_00102979 predicted 484
4 SASI_Rn01_00102980 predicted 550
5 SASI_Rn01_00102982 predicted 242
6 SASI_Rn01_00102983 predicted 230
7 SASI_Rn01_00102984 predicted 583
8 SASI_Rn01_00102985 predicted 553
9 SASI_Rn02_00263453 predicted 373
10 SASI_Rn02_00263454 predicted 445
11 SASI_Rn01_00102978 predicted 507
12 SASI_Rn01_00102981 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028662 predicted 317
2 SASI_Mm01_00028663 predicted 268
3 SASI_Mm01_00028664 predicted 371
4 SASI_Mm02_00323483 predicted 674
5 SASI_Mm01_00028667 predicted 643
6 SASI_Mm01_00028668 predicted 345
7 SASI_Mm02_00323484 predicted 283
8 SASI_Mm01_00028670 predicted 695
9 SASI_Mm01_00028671 predicted 632
10 SASI_Mm02_00323485 predicted 296
11 SASI_Mm01_00028665 predicted 200
12 SASI_Mm01_00028666 predicted 654
13 SASI_Mm01_00028669 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002106
VALIDATED
H2AFZ MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member Z
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-278s1c1
Sequence:CCGGCCGTATTCATCGACACCTAAACTCGAGTTTAGGTGTCGATGAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-381s1c1
Sequence:CCGGGTACTTGAACTGGCAGGAAATCTCGAGATTTCCTGCCAGTTCAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-527s1c1
Sequence:CCGGCCACAAATCTCTGATTGGGAACTCGAGTTCCCAATCAGAGATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-381s21c1
Sequence:CCGGGTACTTGAACTGGCAGGAAATCTCGAGATTTCCTGCCAGTTCAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-459s1c1
Sequence:CCGGCGTGGAGATGAAGAATTGGATCTCGAGATCCAATTCTTCATCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-459s21c1
Sequence:CCGGCGTGGAGATGAAGAATTGGATCTCGAGATCCAATTCTTCATCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-776s21c1
Sequence:CCGGGCTTCAAAGAAGCTATTGATTCTCGAGAATCAATAGCTTCTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-527s21c1
Sequence:CCGGCCACAAATCTCTGATTGGGAACTCGAGTTCCCAATCAGAGATTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002106
VALIDATED
H2AFZ MISSION shRNA shRNA Plasmid DNA
H2A histone family, member Z
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-278s1c1
Sequence:CCGGCCGTATTCATCGACACCTAAACTCGAGTTTAGGTGTCGATGAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-381s1c1
Sequence:CCGGGTACTTGAACTGGCAGGAAATCTCGAGATTTCCTGCCAGTTCAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-527s1c1
Sequence:CCGGCCACAAATCTCTGATTGGGAACTCGAGTTCCCAATCAGAGATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-381s21c1
Sequence:CCGGGTACTTGAACTGGCAGGAAATCTCGAGATTTCCTGCCAGTTCAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-459s1c1
Sequence:CCGGCGTGGAGATGAAGAATTGGATCTCGAGATCCAATTCTTCATCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-459s21c1
Sequence:CCGGCGTGGAGATGAAGAATTGGATCTCGAGATCCAATTCTTCATCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-776s21c1
Sequence:CCGGGCTTCAAAGAAGCTATTGATTCTCGAGAATCAATAGCTTCTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-527s21c1
Sequence:CCGGCCACAAATCTCTGATTGGGAACTCGAGTTCCCAATCAGAGATTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002106
VALIDATED
H2AFZ MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member Z
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-278s1c1
Sequence:CCGGCCGTATTCATCGACACCTAAACTCGAGTTTAGGTGTCGATGAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-381s1c1
Sequence:CCGGGTACTTGAACTGGCAGGAAATCTCGAGATTTCCTGCCAGTTCAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-527s1c1
Sequence:CCGGCCACAAATCTCTGATTGGGAACTCGAGTTCCCAATCAGAGATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-381s21c1
Sequence:CCGGGTACTTGAACTGGCAGGAAATCTCGAGATTTCCTGCCAGTTCAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_002106.3-459s1c1
Sequence:CCGGCGTGGAGATGAAGAATTGGATCTCGAGATCCAATTCTTCATCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-459s21c1
Sequence:CCGGCGTGGAGATGAAGAATTGGATCTCGAGATCCAATTCTTCATCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-776s21c1
Sequence:CCGGGCTTCAAAGAAGCTATTGATTCTCGAGAATCAATAGCTTCTTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002106.3-527s21c1
Sequence:CCGGCCACAAATCTCTGATTGGGAACTCGAGTTCCCAATCAGAGATTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016750
VALIDATED
H2AFZ MISSION shRNA Bacterial Glycerol Stock
H2A histone family, member Z
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016750.1-452s1c1
Sequence:CCGGCGGGAAGAAAGGACAACAGAACTCGAGTTCTGTTGTCCTTTCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-188s1c1
Sequence:CCGGCCGTATTCATCGACACCTGAACTCGAGTTCAGGTGTCGATGAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-348s1c1
Sequence:CCGGCGTCACTTGCAGCTTGCTATACTCGAGTATAGCAAGCTGCAAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-198s1c1
Sequence:CCGGCGACACCTGAAATCTAGGACACTCGAGTGTCCTAGATTTCAGGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-496s1c1
Sequence:CCGGCCTTATTATCTCAGGACTCTACTCGAGTAGAGTCCTGAGATAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-291s21c1
Sequence:CCGGGTACTTGAGTTGGCAGGAAATCTCGAGATTTCCTGCCAACTCAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016750.2-652s21c1
Sequence:CCGGATTCGAGTCTTAACCATATTTCTCGAGAAATATGGTTAAGACTCGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-321s21c1
Sequence:CCGGGACTTAAAGGTAAAGCGTATCCTCGAGGATACGCTTTACCTTTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-482s21c1
Sequence:CCGGAGGATGCCTGGATTCCTTATTCTCGAGAATAAGGAATCCAGGCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016750
VALIDATED
H2AFZ MISSION shRNA shRNA Plasmid DNA
H2A histone family, member Z
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016750.1-452s1c1
Sequence:CCGGCGGGAAGAAAGGACAACAGAACTCGAGTTCTGTTGTCCTTTCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-188s1c1
Sequence:CCGGCCGTATTCATCGACACCTGAACTCGAGTTCAGGTGTCGATGAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-348s1c1
Sequence:CCGGCGTCACTTGCAGCTTGCTATACTCGAGTATAGCAAGCTGCAAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-198s1c1
Sequence:CCGGCGACACCTGAAATCTAGGACACTCGAGTGTCCTAGATTTCAGGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-496s1c1
Sequence:CCGGCCTTATTATCTCAGGACTCTACTCGAGTAGAGTCCTGAGATAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-291s21c1
Sequence:CCGGGTACTTGAGTTGGCAGGAAATCTCGAGATTTCCTGCCAACTCAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016750.2-652s21c1
Sequence:CCGGATTCGAGTCTTAACCATATTTCTCGAGAAATATGGTTAAGACTCGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-321s21c1
Sequence:CCGGGACTTAAAGGTAAAGCGTATCCTCGAGGATACGCTTTACCTTTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-482s21c1
Sequence:CCGGAGGATGCCTGGATTCCTTATTCTCGAGAATAAGGAATCCAGGCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016750
VALIDATED
H2AFZ MISSION shRNA Lentiviral Transduction Particles
H2A histone family, member Z
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016750.1-452s1c1
Sequence:CCGGCGGGAAGAAAGGACAACAGAACTCGAGTTCTGTTGTCCTTTCTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-188s1c1
Sequence:CCGGCCGTATTCATCGACACCTGAACTCGAGTTCAGGTGTCGATGAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-348s1c1
Sequence:CCGGCGTCACTTGCAGCTTGCTATACTCGAGTATAGCAAGCTGCAAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-198s1c1
Sequence:CCGGCGACACCTGAAATCTAGGACACTCGAGTGTCCTAGATTTCAGGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016750.1-496s1c1
Sequence:CCGGCCTTATTATCTCAGGACTCTACTCGAGTAGAGTCCTGAGATAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-291s21c1
Sequence:CCGGGTACTTGAGTTGGCAGGAAATCTCGAGATTTCCTGCCAACTCAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016750.2-652s21c1
Sequence:CCGGATTCGAGTCTTAACCATATTTCTCGAGAAATATGGTTAAGACTCGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-321s21c1
Sequence:CCGGGACTTAAAGGTAAAGCGTATCCTCGAGGATACGCTTTACCTTTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016750.2-482s21c1
Sequence:CCGGAGGATGCCTGGATTCCTTATTCTCGAGAATAAGGAATCCAGGCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)