EMAIL THIS PAGE TO A FRIEND

H2BFM

H2B histone family, member M

68 Gene Product Result for
UniProtKB ID: P0C1H6, A6NP82
Gene ID:
Mouse(69389) H2B histone family, member M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_210048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_210048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_210048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714135 Rosetta Predictions human pricing
XM_001723437 Rosetta Predictions human pricing
XM_210048 Rosetta Predictions human pricing
XM_936705 Rosetta Predictions human pricing
XM_486774 Rosetta Predictions mouse pricing
XM_906752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00395165 predicted 791
2 SASI_Hs02_00395166 predicted 532
3 SASI_Hs02_00395167 predicted 592
4 SASI_Hs02_00395168 predicted 571
5 SASI_Hs02_00395169 predicted 962
6 SASI_Hs02_00395170 predicted 996
7 SASI_Hs02_00395171 predicted 769
8 SASI_Hs02_00395172 predicted 700
9 SASI_Hs02_00395173 predicted 785
10 SASI_Hs02_00395174 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455352 predicted 1024
2 SASI_Hs02_00455353 predicted 288
3 SASI_Hs02_00455354 predicted 1067
4 SASI_Hs02_00455355 predicted 561
5 SASI_Hs02_00455356 predicted 618
6 SASI_Hs02_00455357 predicted 1026
7 SASI_Hs02_00455358 predicted 20
8 SASI_Hs02_00455359 predicted 801
9 SASI_Hs02_00455360 predicted 130
10 SASI_Hs02_00455361 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_210048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300159 predicted 1036
2 SASI_Hs01_00300160 predicted 1035
3 SASI_Hs01_00300161 predicted 295
4 SASI_Hs01_00300162 predicted 1075
5 SASI_Hs01_00300163 predicted 570
6 SASI_Hs01_00300164 predicted 617
7 SASI_Hs01_00300165 predicted 21
8 SASI_Hs01_00300166 predicted 803
9 SASI_Hs01_00300167 predicted 130
10 SASI_Hs01_00300168 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_936705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482200 predicted 819
2 SASI_Hs02_00482201 predicted 557
3 SASI_Hs02_00482202 predicted 612
4 SASI_Hs02_00482203 predicted 601
5 SASI_Hs02_00482204 predicted 995
6 SASI_Hs02_00482205 predicted 1021
7 SASI_Hs02_00482206 predicted 796
8 SASI_Hs02_00482207 predicted 728
9 SASI_Hs02_00482208 predicted 813
10 SASI_Hs02_00482209 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217084 predicted 759
2 SASI_Mm01_00217085 predicted 577
3 SASI_Mm01_00217086 predicted 570
4 SASI_Mm01_00217087 predicted 704
5 SASI_Mm01_00217088 predicted 785
6 SASI_Mm02_00426920 predicted 561
7 SASI_Mm01_00217090 predicted 593
8 SASI_Mm01_00217091 predicted 782
9 SASI_Mm01_00217092 predicted 623
10 SASI_Mm01_00217093 predicted 605
11 SASI_Mm01_00217089 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432713 predicted 757
2 SASI_Mm02_00432714 predicted 570
3 SASI_Mm02_00432715 predicted 573
4 SASI_Mm02_00432716 predicted 707
5 SASI_Mm02_00432717 predicted 778
6 SASI_Mm02_00432718 predicted 559
7 SASI_Mm02_00432719 predicted 596
8 SASI_Mm02_00432720 predicted 782
9 SASI_Mm02_00432721 predicted 620
10 SASI_Mm02_00432722 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027067
H2BFM MISSION shRNA Bacterial Glycerol Stock
H2B histone family, member M
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000363074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-584s21c1
Sequence:CCGGCAAGCCAGAAACTCTACTATCCTCGAGGATAGTAGAGTTTCTGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-611s21c1
Sequence:CCGGAGAGAGATCCAGACCGCTATTCTCGAGAATAGCGGTCTGGATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-683s21c1
Sequence:CCGGATGGCGATGGTCCGGTATATCCTCGAGGATATACCGGACCATCGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-528s21c1
Sequence:CCGGCATTCGTGAAGGATATGTTTGCTCGAGCAAACATATCCTTCACGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027067
H2BFM MISSION shRNA shRNA Plasmid DNA
H2B histone family, member M
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000363074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-584s21c1
Sequence:CCGGCAAGCCAGAAACTCTACTATCCTCGAGGATAGTAGAGTTTCTGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-611s21c1
Sequence:CCGGAGAGAGATCCAGACCGCTATTCTCGAGAATAGCGGTCTGGATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-683s21c1
Sequence:CCGGATGGCGATGGTCCGGTATATCCTCGAGGATATACCGGACCATCGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-528s21c1
Sequence:CCGGCATTCGTGAAGGATATGTTTGCTCGAGCAAACATATCCTTCACGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027067
H2BFM MISSION shRNA Lentiviral Transduction Particles
H2B histone family, member M
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000363074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-584s21c1
Sequence:CCGGCAAGCCAGAAACTCTACTATCCTCGAGGATAGTAGAGTTTCTGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-611s21c1
Sequence:CCGGAGAGAGATCCAGACCGCTATTCTCGAGAATAGCGGTCTGGATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-683s21c1
Sequence:CCGGATGGCGATGGTCCGGTATATCCTCGAGGATATACCGGACCATCGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027067.1-528s21c1
Sequence:CCGGCATTCGTGAAGGATATGTTTGCTCGAGCAAACATATCCTTCACGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_210048
H2BFM MISSION shRNA Bacterial Glycerol Stock
H2B histone family, member M
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-367s1c1
Sequence:CCGGGATTCTATGATCCATGACATACTCGAGTATGTCATGGATCATAGAATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-361s1c1
Sequence:CCGGGTCATGGATTCTATGATCCATCTCGAGATGGATCATAGAATCCATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-93s1c1
Sequence:CCGGTCTCTGTTCTTGCTATCTAATCTCGAGATTAGATAGCAAGAACAGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-532s1c1
Sequence:CCGGGCCCTCAGAACTTCATTATGTCTCGAGACATAATGAAGTTCTGAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-87s1c1
Sequence:CCGGCGTCACTCTCTGTTCTTGCTACTCGAGTAGCAAGAACAGAGAGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_210048
H2BFM MISSION shRNA shRNA Plasmid DNA
H2B histone family, member M
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-367s1c1
Sequence:CCGGGATTCTATGATCCATGACATACTCGAGTATGTCATGGATCATAGAATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-361s1c1
Sequence:CCGGGTCATGGATTCTATGATCCATCTCGAGATGGATCATAGAATCCATGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-93s1c1
Sequence:CCGGTCTCTGTTCTTGCTATCTAATCTCGAGATTAGATAGCAAGAACAGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-532s1c1
Sequence:CCGGGCCCTCAGAACTTCATTATGTCTCGAGACATAATGAAGTTCTGAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-87s1c1
Sequence:CCGGCGTCACTCTCTGTTCTTGCTACTCGAGTAGCAAGAACAGAGAGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_210048
H2BFM MISSION shRNA Lentiviral Transduction Particles
H2B histone family, member M
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-367s1c1
Sequence:CCGGGATTCTATGATCCATGACATACTCGAGTATGTCATGGATCATAGAATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-361s1c1
Sequence:CCGGGTCATGGATTCTATGATCCATCTCGAGATGGATCATAGAATCCATGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-93s1c1
Sequence:CCGGTCTCTGTTCTTGCTATCTAATCTCGAGATTAGATAGCAAGAACAGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-532s1c1
Sequence:CCGGGCCCTCAGAACTTCATTATGTCTCGAGACATAATGAAGTTCTGAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_210048.3-87s1c1
Sequence:CCGGCGTCACTCTCTGTTCTTGCTACTCGAGTAGCAAGAACAGAGAGTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)