EMAIL THIS PAGE TO A FRIEND

H2BFS

H2B histone family, member S (pseudogene)

10 Gene Product Result for
Species: Human H2BFS(54145)
UniProtKB ID: P57053, A0AVF9, Q5R2W0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502228 Anti-Histone H2B (Acetyl-Lys12) antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502229 Anti-Histone H2B (Acetyl-Lys15) antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502227 Anti-Histone H2B (Acetyl-Lys5) antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502230 Anti-Histone H2B antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4502231 Anti-Histone H2B antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502232 Anti-Histone H2B antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017445 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148771 MISSION® esiRNA esiRNA human H2BFS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017445 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137731 predicted 40
2 SASI_Hs01_00137732 predicted 27
3 SASI_Hs01_00137733 predicted 28
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017445
H2BFS MISSION shRNA Bacterial Glycerol Stock
H2B histone family, member S (pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-159s1c1
Sequence:CCGGCGGCATCTCCTCTAAGGCCATCTCGAGATGGCCTTAGAGGAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-201s1c1
Sequence:CCGGCAACGACATCTTCGAACGCATCTCGAGATGCGTTCGAAGATGTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-54s1c1
Sequence:CCGGCGTGACTAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-30s1c1
Sequence:CCGGGCCCAAGAAGGGCTCGAAGAACTCGAGTTCTTCGAGCCCTTCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-66s1c1
Sequence:CCGGGCAGAAGAAGGACGGCAGGAACTCGAGTTCCTGCCGTCCTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017445
H2BFS MISSION shRNA shRNA Plasmid DNA
H2B histone family, member S (pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-159s1c1
Sequence:CCGGCGGCATCTCCTCTAAGGCCATCTCGAGATGGCCTTAGAGGAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-201s1c1
Sequence:CCGGCAACGACATCTTCGAACGCATCTCGAGATGCGTTCGAAGATGTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-54s1c1
Sequence:CCGGCGTGACTAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-30s1c1
Sequence:CCGGGCCCAAGAAGGGCTCGAAGAACTCGAGTTCTTCGAGCCCTTCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-66s1c1
Sequence:CCGGGCAGAAGAAGGACGGCAGGAACTCGAGTTCCTGCCGTCCTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017445
H2BFS MISSION shRNA Lentiviral Transduction Particles
H2B histone family, member S (pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-159s1c1
Sequence:CCGGCGGCATCTCCTCTAAGGCCATCTCGAGATGGCCTTAGAGGAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-201s1c1
Sequence:CCGGCAACGACATCTTCGAACGCATCTCGAGATGCGTTCGAAGATGTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-54s1c1
Sequence:CCGGCGTGACTAAGGCGCAGAAGAACTCGAGTTCTTCTGCGCCTTAGTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-30s1c1
Sequence:CCGGGCCCAAGAAGGGCTCGAAGAACTCGAGTTCTTCGAGCCCTTCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017445.1-66s1c1
Sequence:CCGGGCAGAAGAAGGACGGCAGGAACTCGAGTTCCTGCCGTCCTTCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)