EMAIL THIS PAGE TO A FRIEND

H3F3A

H3 histone, family 3A

27 Gene Product Result for
Synonyms: H3.3A H3F3
Gene ID:
Human(3020) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is polyadenylated, unlike most histone genes. The protein encoded is a replication-independent member of the histone H3 family. [provided by RefSeq, Jul 2008]
Mouse(15078) H3 histone, family 3A
Rat(289314) H3 histone, family 3A
sheep(100135447) H3 histone, family 3A
domestic guinea pig(100735236) H3 histone, family 3A
Zebrafish(406269) H3 histone, family 3A
cow(326601) H3 histone, family 3A
domestic cat(100169960) H3 histone, family 3A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
SAB2701933 Anti-h3f3a antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
HPA042570 Anti-H3F3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
SAB4501373 Anti-Histone H3.3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4504092 Anti-phospho-Histone H3.3 (pSer31) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127091 MISSION® esiRNA esiRNA targeting human H3F3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002107 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333221 predicted 138
2 SASI_Hs02_00333222 predicted 370
3 SASI_Hs01_00222708 predicted 1008
4 SASI_Hs01_00222709 predicted 883
5 SASI_Hs02_00333223 predicted 145
6 SASI_Hs01_00222706 predicted 145
7 SASI_Hs01_00222707 predicted 674
8 SASI_Hs01_00222710 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002107
H3F3A MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-886s1c1
Sequence:CCGGGATGGCAACTAAATGGTGTTTCTCGAGAAACACCATTTAGTTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-166s1c1
Sequence:CCGGCAGGAAGCAACTGGCTACAAACTCGAGTTTGTAGCCAGTTGCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-258s1c1
Sequence:CCGGCGCTCCGTGAAATTAGACGTTCTCGAGAACGTCTAATTTCACGGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-288s1c1
Sequence:CCGGCCACTGAACTTCTGATTCGCACTCGAGTGCGAATCAGAAGTTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-301s1c1
Sequence:CCGGGATTCGCAAACTTCCCTTCCACTCGAGTGGAAGGGAAGTTTGCGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-283s1c1
Sequence:CCGGGAAGTCCACTGAACTTCTGATCTCGAGATCAGAAGTTCAGTGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-738s1c1
Sequence:CCGGGCGGAGACGTAAAGCATTAATCTCGAGATTAATGCTTTACGTCTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-531s1c1
Sequence:CCGGCCACTATGATGGGAAACATTTCTCGAGAAATGTTTCCCATCATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-293s1c1
Sequence:CCGGGAACTTCTGATTCGCAAACTTCTCGAGAAGTTTGCGAATCAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002107
H3F3A MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-886s1c1
Sequence:CCGGGATGGCAACTAAATGGTGTTTCTCGAGAAACACCATTTAGTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-166s1c1
Sequence:CCGGCAGGAAGCAACTGGCTACAAACTCGAGTTTGTAGCCAGTTGCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-258s1c1
Sequence:CCGGCGCTCCGTGAAATTAGACGTTCTCGAGAACGTCTAATTTCACGGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-288s1c1
Sequence:CCGGCCACTGAACTTCTGATTCGCACTCGAGTGCGAATCAGAAGTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-301s1c1
Sequence:CCGGGATTCGCAAACTTCCCTTCCACTCGAGTGGAAGGGAAGTTTGCGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-283s1c1
Sequence:CCGGGAAGTCCACTGAACTTCTGATCTCGAGATCAGAAGTTCAGTGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-738s1c1
Sequence:CCGGGCGGAGACGTAAAGCATTAATCTCGAGATTAATGCTTTACGTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-531s1c1
Sequence:CCGGCCACTATGATGGGAAACATTTCTCGAGAAATGTTTCCCATCATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-293s1c1
Sequence:CCGGGAACTTCTGATTCGCAAACTTCTCGAGAAGTTTGCGAATCAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002107
H3F3A MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-886s1c1
Sequence:CCGGGATGGCAACTAAATGGTGTTTCTCGAGAAACACCATTTAGTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-166s1c1
Sequence:CCGGCAGGAAGCAACTGGCTACAAACTCGAGTTTGTAGCCAGTTGCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-258s1c1
Sequence:CCGGCGCTCCGTGAAATTAGACGTTCTCGAGAACGTCTAATTTCACGGAGCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-288s1c1
Sequence:CCGGCCACTGAACTTCTGATTCGCACTCGAGTGCGAATCAGAAGTTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-301s1c1
Sequence:CCGGGATTCGCAAACTTCCCTTCCACTCGAGTGGAAGGGAAGTTTGCGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-283s1c1
Sequence:CCGGGAAGTCCACTGAACTTCTGATCTCGAGATCAGAAGTTCAGTGGACTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142454    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-738s1c1
Sequence:CCGGGCGGAGACGTAAAGCATTAATCTCGAGATTAATGCTTTACGTCTCCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144286    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002107.3-531s1c1
Sequence:CCGGCCACTATGATGGGAAACATTTCTCGAGAAATGTTTCCCATCATAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002107.2-293s1c1
Sequence:CCGGGAACTTCTGATTCGCAAACTTCTCGAGAAGTTTGCGAATCAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008210
H3F3A MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-208s1c1
Sequence:CCGGCCAGGAAACAACTGGCTACAACTCGAGTTGTAGCCAGTTGTTTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-497s1c1
Sequence:CCGGCCATGCCAAACGTGTAACAATCTCGAGATTGTTACACGTTTGGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-634s21c1
Sequence:CCGGGTAGTTCTGAATGTTAGATATCTCGAGATATCTAACATTCAGAACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008210.2-740s1c1
Sequence:CCGGCGTTCATTTGTGTGTGAATTTCTCGAGAAATTCACACACAAATGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-374s1c1
Sequence:CCGGGCGAGAAATTGCTCAGGACTTCTCGAGAAGTCCTGAGCAATTTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-318s1c1
Sequence:CCGGCGCTATCAGAAGTCCACTGAACTCGAGTTCAGTGGACTTCTGATAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-548s21c1
Sequence:CCGGTACGCGGAGAACGTGCTTAAGCTCGAGCTTAAGCACGTTCTCCGCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-814s21c1
Sequence:CCGGCATTTCAACAGTTCAACTTTACTCGAGTAAAGTTGAACTGTTGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-182s21c1
Sequence:CCGGGCAAATCCACCGGTGGTAAAGCTCGAGCTTTACCACCGGTGGATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-291s21c1
Sequence:CCGGTACTGTGGCCCTCCGTGAAATCTCGAGATTTCACGGAGGGCCACAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008210
H3F3A MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-208s1c1
Sequence:CCGGCCAGGAAACAACTGGCTACAACTCGAGTTGTAGCCAGTTGTTTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-497s1c1
Sequence:CCGGCCATGCCAAACGTGTAACAATCTCGAGATTGTTACACGTTTGGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-634s21c1
Sequence:CCGGGTAGTTCTGAATGTTAGATATCTCGAGATATCTAACATTCAGAACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008210.2-740s1c1
Sequence:CCGGCGTTCATTTGTGTGTGAATTTCTCGAGAAATTCACACACAAATGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-374s1c1
Sequence:CCGGGCGAGAAATTGCTCAGGACTTCTCGAGAAGTCCTGAGCAATTTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-318s1c1
Sequence:CCGGCGCTATCAGAAGTCCACTGAACTCGAGTTCAGTGGACTTCTGATAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-548s21c1
Sequence:CCGGTACGCGGAGAACGTGCTTAAGCTCGAGCTTAAGCACGTTCTCCGCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-814s21c1
Sequence:CCGGCATTTCAACAGTTCAACTTTACTCGAGTAAAGTTGAACTGTTGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-182s21c1
Sequence:CCGGGCAAATCCACCGGTGGTAAAGCTCGAGCTTTACCACCGGTGGATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-291s21c1
Sequence:CCGGTACTGTGGCCCTCCGTGAAATCTCGAGATTTCACGGAGGGCCACAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008210
H3F3A MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-208s1c1
Sequence:CCGGCCAGGAAACAACTGGCTACAACTCGAGTTGTAGCCAGTTGTTTCCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-497s1c1
Sequence:CCGGCCATGCCAAACGTGTAACAATCTCGAGATTGTTACACGTTTGGCATGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420184    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-634s21c1
Sequence:CCGGGTAGTTCTGAATGTTAGATATCTCGAGATATCTAACATTCAGAACTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008210.2-740s1c1
Sequence:CCGGCGTTCATTTGTGTGTGAATTTCTCGAGAAATTCACACACAAATGAACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-374s1c1
Sequence:CCGGGCGAGAAATTGCTCAGGACTTCTCGAGAAGTCCTGAGCAATTTCTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008210.2-318s1c1
Sequence:CCGGCGCTATCAGAAGTCCACTGAACTCGAGTTCAGTGGACTTCTGATAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-548s21c1
Sequence:CCGGTACGCGGAGAACGTGCTTAAGCTCGAGCTTAAGCACGTTCTCCGCGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008210.4-814s21c1
Sequence:CCGGCATTTCAACAGTTCAACTTTACTCGAGTAAAGTTGAACTGTTGAAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-182s21c1
Sequence:CCGGGCAAATCCACCGGTGGTAAAGCTCGAGCTTTACCACCGGTGGATTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008210.4-291s21c1
Sequence:CCGGTACTGTGGCCCTCCGTGAAATCTCGAGATTTCACGGAGGGCCACAGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)