EMAIL THIS PAGE TO A FRIEND

H3F3B

H3 histone, family 3B (H3.3B)

231 Gene Product Result for
Synonyms: H3.3B
Gene ID:
Human(3021) Summary: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene contains introns and its mRNA is poyadenylated, unlike most histone genes. The protein encoded is a member of the histone H3 family. [provided by RefSeq, Jul 2008]
Mouse(15081) H3 histone, family 3B
Rat(117056) H3 histone, family 3B
chicken(396233) H3 histone, family 3B
dog(475916) H3 histone, family 3B (H3.3B)
dog(480110) H3 histone, family 3B (H3.3B)
domestic cat(101080845) H3 histone, family 3B (H3.3B)
cow(617051) H3 histone, family 3B
sheep(101108931) H3 histone, family 3B (H3.3B)
domestic guinea pig(100719363) H3 histone, family 3B (H3.3B)
naked mole-rat(101698172) H3 histone, family 3B (H3.3B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H9161 Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, bovine, human, mouse, Caenorhabditis elegans, Drosophila, rat, chicken
immunofluorescence, microarray, western blot pricing
H9286 Anti-acetyl-Histone H3 (Ac-Lys9) antibody produced in rabbit 2-2.5 mg/mL, affinity isolated antibody, buffered aqueous solution Drosophila, human, bovine, frog, chicken, Caenorhabditis elegans, rat, mouse
immunofluorescence, microarray, western blot pricing
H0913 Anti-acetyl-Histone H3 (Ac-Lys9) antibody, Mouse monoclonal clone AH3-120, purified from hybridoma cell culture human, mouse, bovine, frog, chicken, rat, Caenorhabditis elegans, Drosophila
ELISA, immunocytochemistry, microarray, western blot pricing
D5692 Anti-dimethyl-Histone H3 (diMe-Lys4) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Caenorhabditis elegans, Arabidopsis thaliana, Drosophila, human, bovine, frog, rat, chicken, mouse
ChIP, microarray, western blot pricing
D5567 Anti-dimethyl-Histone H3 (diMe-Lys9) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Arabidopsis thaliana, Drosophila, Caenorhabditis elegans, bovine, human, chicken, frog, rat, mouse
ChIP, microarray, western blot pricing
H0164 Anti-Histone H3 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, plant, human, Drosophila, rat, chicken, Xenopus
immunofluorescence, western blot pricing
SAB1306556 ANTI-HISTONE H3-K9 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
M4819 Anti-methyl-Histone H3 (Me-Lys4) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, Caenorhabditis elegans, Drosophila, bovine, mouse, human, frog, Arabidopsis thaliana, rat
western blot pricing
H7162 Anti-methyl-Histone H3 (Me-Lys9) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution Caenorhabditis elegans, mouse, rat, bovine, chicken, frog, Drosophila, human
microarray, western blot pricing
H0412 Anti-phospho-Histone H3 (pSer10) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, human, mouse, Drosophila, rat, Caenorhabditis elegans, bovine, chicken
immunofluorescence, microarray, western blot pricing
SAB4504092 Anti-phospho-Histone H3.3 (pSer31) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence pricing
SAB4800015 Imprint® Anti-H3K27me3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800025 Imprint® Anti-H3K27me3 antibody produced in rabbit whole antiserum, buffered aqueous solution human, mouse
ChIP, ELISA, immunofluorescence, western blot pricing
SAB4800033 Imprint® Anti-H3K27me3S28p antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4800021 Imprint® Anti-H3K36me1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800037 Imprint® Anti-H3K36me2 antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800006 Imprint® Anti-H3K36me3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800028 Imprint® Anti-H3K36me3 antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800022 Imprint® Anti-H3K4ac, (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution yeast, human
ChIP, ELISA, immunofluorescence, western blot pricing
SAB4800010 Imprint® Anti-H3K4me1, (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800008 Imprint® Anti-H3K4me2, (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800026 Imprint® Anti-H3K4me3, (C-terminal) antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800003 Imprint® Anti-H3K4me3, (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, western blot pricing
SAB4800043 Imprint® Anti-H3K79me1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800029 Imprint® Anti-H3K79me2 antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800007 Imprint® Anti-H3K9/14ac antibody produced in rabbit affinity isolated antibody, only recognizes K9/K14 diacetylated H3, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800044 Imprint® Anti-H3K9acS10p antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800016 Imprint® Anti-H3K9me1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800031 Imprint® Anti-H3K9me1 antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, immunofluorescence, western blot pricing
SAB4800005 Imprint® Anti-H3K9me2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ChIP, ELISA, immunofluorescence, western blot pricing
SAB4800004 Imprint® Anti-H3K9me3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800027 Imprint® Anti-H3K9me3 antibody produced in rabbit whole antiserum, buffered aqueous solution human, mouse
ChIP, ELISA, immunofluorescence, western blot pricing
SAB4800045 Imprint® Anti-H3K9me3S10p antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800009 Imprint® Anti-H3Pan antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800038 Imprint® Anti-H3R17me2 antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, western blot pricing
SAB4800023 Imprint® Anti-H3S10p antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, immunofluorescence, western blot pricing
SAB4800036 Imprint® Anti-H3S10p antibody produced in rabbit whole antiserum, buffered aqueous solution human
ChIP, ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB5100007 Imprint®ChIP-Validated Anti-Acetyl-Histone H3 (Ac-Lys9) (H3K9ac) antibody produced in rabbit affinity isolated antibody human
ChIP, western blot pricing
SAB5100009 Imprint ® ChiP-Validated Anti-methyl-Histone H3 (Me-Lys4) (H3K4me1) antibody produced in rabbit affinity isolated antibody chicken, frog, mouse, bovine, human
ChIP, western blot pricing
SAB5100008 Imprint® ChIP-Validated Anti-methyl-Histone H3 (Me-Lys9) (H3K9me1) affinity isolated antibody human
ChIP, western blot pricing
SAB4800018 Imprint® Monoclonal Anti-H3K9me3 antibody produced in mouse affinity isolated antibody, buffered aqueous solution human
ChIP, western blot pricing
SAB4800030 Imprint® Monoclonal Anti-H3K9me3 antibody produced in rabbit culture supernatant, buffered aqueous solution human
ChIP, western blot pricing
H0788 Monoclonal Anti-acetyl- & phospho-Histone H3 (Ac-Lys9, pSer10) antibody produced in mouse ~2 mg/mL, clone APH3-64, purified immunoglobulin, buffered aqueous solution frog, rat, Drosophila, Caenorhabditis elegans, human, mouse, bovine, chicken
ELISA, immunoprecipitation (IP), microarray, western blot pricing
WH0003021M1 Monoclonal Anti-H3F3B antibody produced in mouse clone 2D7-H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H9908 Monoclonal Anti-phospho-Histone H3 (pSer28) antibody produced in rat ~0.5 mg/mL, clone HTA28, purified immunoglobulin, buffered aqueous solution human, bovine, hamster, mouse
flow cytometry, immunocytochemistry, microarray, western blot pricing
SAB1305499 MONOCLONAL ANTI-PHOSPHO-HISTONE H3(S10) antibody produced in mouse clone 44AT1232.94, IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1305498 MONOCLONAL ANTI-PHOSPHO-HISTONE H3(S10) antibody produced in mouse clone 44AT1232, IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB1305497 MONOCLONAL ANTI-PHOSPHO-HISTONE H3(S10) antibody produced in mouse clone 44AT1032.72, crude ascites, buffered aqueous solution human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005324 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109921 MISSION® esiRNA esiRNA human H3F3B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005324 Rosetta Predictions human pricing
NM_053985 Rosetta Predictions rat pricing
NM_008211 Rosetta Predictions mouse pricing
XM_895309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142376 predicted 745
2 SASI_Hs01_00142377 predicted 736
3 SASI_Hs01_00142378 predicted 433
4 SASI_Hs01_00142379 predicted 437
5 SASI_Hs01_00142380 predicted 623
6 SASI_Hs01_00142375 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032712 predicted 762
2 SASI_Rn01_00032713 predicted 758
3 SASI_Rn01_00032714 predicted 729
4 SASI_Rn01_00032715 predicted 196
5 SASI_Rn01_00032716 predicted 350
6 SASI_Rn01_00032717 predicted 540
7 SASI_Rn01_00032718 predicted 305
8 SASI_Rn01_00032719 predicted 671
9 SASI_Rn01_00032720 predicted 286
10 SASI_Rn02_00266982 predicted 444
11 SASI_Rn01_00032711 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022945 predicted 768
2 SASI_Mm01_00022946 predicted 408
3 SASI_Mm01_00022947 predicted 717
4 SASI_Mm01_00022948 predicted 350
5 SASI_Mm01_00022950 predicted 536
6 SASI_Mm01_00022951 predicted 672
7 SASI_Mm01_00022952 predicted 729
8 SASI_Mm02_00313378 predicted 443
9 SASI_Mm01_00022953 predicted 510
10 SASI_Mm01_00022954 predicted 541
11 SASI_Mm01_00022949 predicted 2497
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261083 predicted 1127
2 SASI_Mm01_00261084 predicted 1079
3 SASI_Mm01_00261085 predicted 1119
4 SASI_Mm01_00261086 predicted 1081
5 SASI_Mm01_00261087 predicted 1086
6 SASI_Mm01_00261088 predicted 1124
7 SASI_Mm01_00261089 predicted 1087
8 SASI_Mm01_00261090 predicted 1114
9 SASI_Mm01_00261091 predicted 1092
10 SASI_Mm01_00261092 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008211
VALIDATED
H3F3B MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3B (H3.3B)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-356s21c1
Sequence:CCGGGAGATCGCCCAGGATTTCAAACTCGAGTTTGAAATCCTGGGCGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-328s21c1
Sequence:CCGGGAAGCTGCCATTCCAGAGATTCTCGAGAATCTCTGGAATGGCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008211.3-968s21c1
Sequence:CCGGCCACAGTGTAACAGTTTCCTTCTCGAGAAGGAAACTGTTACACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008211.2-2706s1c1
Sequence:CCGGCCACAGTGTAACAGTTTCCTTCTCGAGAAGGAAACTGTTACACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2123s1c1
Sequence:CCGGGAGGTTTCAAAGTGCAGCCATCTCGAGATGGCTGCACTTTGAAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2066s1c1
Sequence:CCGGGAAGCTGCCATTCCAGAGATTCTCGAGAATCTCTGGAATGGCAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2213s1c1
Sequence:CCGGCCACGCCAAGAGAGTCACCATCTCGAGATGGTGACTCTCTTGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008211.2-2018s1c1
Sequence:CCGGTCTGAGAGAGATCCGTCGTTACTCGAGTAACGACGGATCTCTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-280s21c1
Sequence:CCGGTCTGAGAGAGATCCGTCGTTACTCGAGTAACGACGGATCTCTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008211.3-415s21c1
Sequence:CCGGTCAGGAGGCTAGCGAAGCATACTCGAGTATGCTTCGCTAGCCTCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008211
VALIDATED
H3F3B MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3B (H3.3B)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-356s21c1
Sequence:CCGGGAGATCGCCCAGGATTTCAAACTCGAGTTTGAAATCCTGGGCGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-328s21c1
Sequence:CCGGGAAGCTGCCATTCCAGAGATTCTCGAGAATCTCTGGAATGGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008211.3-968s21c1
Sequence:CCGGCCACAGTGTAACAGTTTCCTTCTCGAGAAGGAAACTGTTACACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008211.2-2706s1c1
Sequence:CCGGCCACAGTGTAACAGTTTCCTTCTCGAGAAGGAAACTGTTACACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2123s1c1
Sequence:CCGGGAGGTTTCAAAGTGCAGCCATCTCGAGATGGCTGCACTTTGAAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2066s1c1
Sequence:CCGGGAAGCTGCCATTCCAGAGATTCTCGAGAATCTCTGGAATGGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2213s1c1
Sequence:CCGGCCACGCCAAGAGAGTCACCATCTCGAGATGGTGACTCTCTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008211.2-2018s1c1
Sequence:CCGGTCTGAGAGAGATCCGTCGTTACTCGAGTAACGACGGATCTCTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-280s21c1
Sequence:CCGGTCTGAGAGAGATCCGTCGTTACTCGAGTAACGACGGATCTCTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008211.3-415s21c1
Sequence:CCGGTCAGGAGGCTAGCGAAGCATACTCGAGTATGCTTCGCTAGCCTCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008211
VALIDATED
H3F3B MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3B (H3.3B)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-356s21c1
Sequence:CCGGGAGATCGCCCAGGATTTCAAACTCGAGTTTGAAATCCTGGGCGATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-328s21c1
Sequence:CCGGGAAGCTGCCATTCCAGAGATTCTCGAGAATCTCTGGAATGGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008211.3-968s21c1
Sequence:CCGGCCACAGTGTAACAGTTTCCTTCTCGAGAAGGAAACTGTTACACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092918    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008211.2-2706s1c1
Sequence:CCGGCCACAGTGTAACAGTTTCCTTCTCGAGAAGGAAACTGTTACACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2123s1c1
Sequence:CCGGGAGGTTTCAAAGTGCAGCCATCTCGAGATGGCTGCACTTTGAAACCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2066s1c1
Sequence:CCGGGAAGCTGCCATTCCAGAGATTCTCGAGAATCTCTGGAATGGCAGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008211.2-2213s1c1
Sequence:CCGGCCACGCCAAGAGAGTCACCATCTCGAGATGGTGACTCTCTTGGCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008211.2-2018s1c1
Sequence:CCGGTCTGAGAGAGATCCGTCGTTACTCGAGTAACGACGGATCTCTCTCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008211.3-280s21c1
Sequence:CCGGTCTGAGAGAGATCCGTCGTTACTCGAGTAACGACGGATCTCTCTCAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008211.3-415s21c1
Sequence:CCGGTCAGGAGGCTAGCGAAGCATACTCGAGTATGCTTCGCTAGCCTCCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005324
VALIDATED
H3F3B MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3B (H3.3B)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005324.3-475s21c1
Sequence:CCGGCGCTAAGAGAGTCACCATCATCTCGAGATGATGGTGACTCTCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-809s21c1
Sequence:CCGGGACTTGTTGGGTAGCTATTAACTCGAGTTAATAGCTACCCAACAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-277s21c1
Sequence:CCGGGCTTCGAGAGATTCGTCGTTACTCGAGTAACGACGAATCTCTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-436s21c1
Sequence:CCGGGGTGGGTCTGTTCGAAGATACCTCGAGGTATCTTCGAACAGACCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005324.3-493s21c1
Sequence:CCGGCATGCCCAAAGACATCCAGTTCTCGAGAACTGGATGTCTTTGGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-1213s1c1
Sequence:CCGGGCGCATTTATACCTTGCATAACTCGAGTTATGCAAGGTATAAATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005324.3-475s1c1
Sequence:CCGGCGCTAAGAGAGTCACCATCATCTCGAGATGATGGTGACTCTCTTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-277s1c1
Sequence:CCGGGCTTCGAGAGATTCGTCGTTACTCGAGTAACGACGAATCTCTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-493s1c1
Sequence:CCGGCATGCCCAAAGACATCCAGTTCTCGAGAACTGGATGTCTTTGGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005324.3-472s1c1
Sequence:CCGGCCACGCTAAGAGAGTCACCATCTCGAGATGGTGACTCTCTTAGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005324
VALIDATED
H3F3B MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3B (H3.3B)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005324.3-475s21c1
Sequence:CCGGCGCTAAGAGAGTCACCATCATCTCGAGATGATGGTGACTCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-809s21c1
Sequence:CCGGGACTTGTTGGGTAGCTATTAACTCGAGTTAATAGCTACCCAACAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-277s21c1
Sequence:CCGGGCTTCGAGAGATTCGTCGTTACTCGAGTAACGACGAATCTCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-436s21c1
Sequence:CCGGGGTGGGTCTGTTCGAAGATACCTCGAGGTATCTTCGAACAGACCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005324.3-493s21c1
Sequence:CCGGCATGCCCAAAGACATCCAGTTCTCGAGAACTGGATGTCTTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-1213s1c1
Sequence:CCGGGCGCATTTATACCTTGCATAACTCGAGTTATGCAAGGTATAAATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005324.3-475s1c1
Sequence:CCGGCGCTAAGAGAGTCACCATCATCTCGAGATGATGGTGACTCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-277s1c1
Sequence:CCGGGCTTCGAGAGATTCGTCGTTACTCGAGTAACGACGAATCTCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-493s1c1
Sequence:CCGGCATGCCCAAAGACATCCAGTTCTCGAGAACTGGATGTCTTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005324.3-472s1c1
Sequence:CCGGCCACGCTAAGAGAGTCACCATCTCGAGATGGTGACTCTCTTAGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005324
VALIDATED
H3F3B MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3B (H3.3B)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005324.3-475s21c1
Sequence:CCGGCGCTAAGAGAGTCACCATCATCTCGAGATGATGGTGACTCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296064    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-809s21c1
Sequence:CCGGGACTTGTTGGGTAGCTATTAACTCGAGTTAATAGCTACCCAACAAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-277s21c1
Sequence:CCGGGCTTCGAGAGATTCGTCGTTACTCGAGTAACGACGAATCTCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005324.3-436s21c1
Sequence:CCGGGGTGGGTCTGTTCGAAGATACCTCGAGGTATCTTCGAACAGACCCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005324.3-493s21c1
Sequence:CCGGCATGCCCAAAGACATCCAGTTCTCGAGAACTGGATGTCTTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-1213s1c1
Sequence:CCGGGCGCATTTATACCTTGCATAACTCGAGTTATGCAAGGTATAAATGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005324.3-475s1c1
Sequence:CCGGCGCTAAGAGAGTCACCATCATCTCGAGATGATGGTGACTCTCTTAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-277s1c1
Sequence:CCGGGCTTCGAGAGATTCGTCGTTACTCGAGTAACGACGAATCTCTCGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005324.3-493s1c1
Sequence:CCGGCATGCCCAAAGACATCCAGTTCTCGAGAACTGGATGTCTTTGGGCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005324.3-472s1c1
Sequence:CCGGCCACGCTAAGAGAGTCACCATCTCGAGATGGTGACTCTCTTAGCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)