EMAIL THIS PAGE TO A FRIEND

H3F3C

H3 histone, family 3C

10 Gene Product Result for
Synonyms: H3.5
UniProtKB ID: Q6NXT2, E9P281
Gene ID:
Mouse(625328) H3 histone, family 3C
Rat(100360868) H3 histone, family 3C
Zebrafish(336231) H3 histone, family 3C
cow(539855) histone H3-like
chicken(427887) H3 histone, family 3C
cow(512741) H3 histone, family 3C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013699 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013699 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197487 predicted 369
2 SASI_Hs01_00197488 predicted 376
3 SASI_Hs01_00197489 predicted 295
4 SASI_Hs01_00197486 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013699
H3F3C MISSION shRNA Bacterial Glycerol Stock
H3 histone, family 3C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-300s1c1
Sequence:CCGGGCAGGATTTCAACACTGACCTCTCGAGAGGTCAGTGTTGAAATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-377s1c1
Sequence:CCGGTGGGTCTGTTGGAAGATACTACTCGAGTAGTATCTTCCAACAGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-276s1c1
Sequence:CCGGCCAGAGGTTGGTGAGGGAGATCTCGAGATCTCCCTCACCAACCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013699.1-874s1c1
Sequence:CCGGCTGTGATAGAATGTAGGCTTTCTCGAGAAAGCCTACATTCTATCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-139s1c1
Sequence:CCGGGCCACGAAAGCTGCCAGGAAACTCGAGTTTCCTGGCAGCTTTCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013699
H3F3C MISSION shRNA shRNA Plasmid DNA
H3 histone, family 3C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-300s1c1
Sequence:CCGGGCAGGATTTCAACACTGACCTCTCGAGAGGTCAGTGTTGAAATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-377s1c1
Sequence:CCGGTGGGTCTGTTGGAAGATACTACTCGAGTAGTATCTTCCAACAGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-276s1c1
Sequence:CCGGCCAGAGGTTGGTGAGGGAGATCTCGAGATCTCCCTCACCAACCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013699.1-874s1c1
Sequence:CCGGCTGTGATAGAATGTAGGCTTTCTCGAGAAAGCCTACATTCTATCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-139s1c1
Sequence:CCGGGCCACGAAAGCTGCCAGGAAACTCGAGTTTCCTGGCAGCTTTCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013699
H3F3C MISSION shRNA Lentiviral Transduction Particles
H3 histone, family 3C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-300s1c1
Sequence:CCGGGCAGGATTTCAACACTGACCTCTCGAGAGGTCAGTGTTGAAATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-377s1c1
Sequence:CCGGTGGGTCTGTTGGAAGATACTACTCGAGTAGTATCTTCCAACAGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-276s1c1
Sequence:CCGGCCAGAGGTTGGTGAGGGAGATCTCGAGATCTCCCTCACCAACCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013699.1-874s1c1
Sequence:CCGGCTGTGATAGAATGTAGGCTTTCTCGAGAAAGCCTACATTCTATCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013699.1-139s1c1
Sequence:CCGGGCCACGAAAGCTGCCAGGAAACTCGAGTTTCCTGGCAGCTTTCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)