EMAIL THIS PAGE TO A FRIEND

H6PD

hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)

53 Gene Product Result for
Synonyms: CORTRD1 G6PDH GDH
UniProtKB ID: O95479, Q4TT33, Q66I35, Q68DT3
Gene ID:
Human(9563) Summary: There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
Mouse(100198) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Rat(298655) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
sheep(101114124) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
domestic guinea pig(100729270) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
naked mole-rat(101715539) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Zebrafish(569348) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
cow(541220) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
cow(280803) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Horse(100057646) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
dog(489642) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
domestic cat(101098066) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
chicken(428188) hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004285 Rosetta Predictions human pricing
NM_001106698 Rosetta Predictions rat pricing
NM_173371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158494 predicted 1790
2 SASI_Hs01_00158495 predicted 599
3 SASI_Hs01_00158496 predicted 1777
4 SASI_Hs01_00158497 predicted 824
5 SASI_Hs01_00158498 predicted 982
6 SASI_Hs01_00158500 predicted 277
7 SASI_Hs01_00158501 predicted 2466
8 SASI_Hs01_00158502 predicted 487
9 SASI_Hs01_00158503 predicted 1045
10 SASI_Hs02_00337276 predicted 938
11 SASI_Hs01_00158499 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221508 predicted 735
2 SASI_Rn02_00221509 predicted 2661
3 SASI_Rn02_00221510 predicted 1382
4 SASI_Rn02_00221511 predicted 351
5 SASI_Rn02_00221512 predicted 878
6 SASI_Rn02_00221513 predicted 2624
7 SASI_Rn02_00221514 predicted 2032
8 SASI_Rn02_00221515 predicted 1878
9 SASI_Rn02_00221516 predicted 1762
10 SASI_Rn02_00221517 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096000 predicted 334
2 SASI_Mm01_00096001 predicted 724
3 SASI_Mm02_00345181 predicted 2657
4 SASI_Mm01_00096002 predicted 350
5 SASI_Mm02_00345182 predicted 559
6 SASI_Mm01_00096003 predicted 1872
7 SASI_Mm01_00096004 predicted 2413
8 SASI_Mm01_00096005 predicted 413
9 SASI_Mm01_00096007 predicted 1927
10 SASI_Mm01_00096008 predicted 876
11 SASI_Mm01_00096006 predicted 2037
12 SASI_Mm01_00096009 predicted 1882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173371
VALIDATED
H6PD MISSION shRNA Bacterial Glycerol Stock
hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173371.3-4328s21c1
Sequence:CCGGGCCTAGAATGTCCCGTTCTTACTCGAGTAAGAACGGGACATTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-877s21c1
Sequence:CCGGGATGTACCGTGTGGATCATTACTCGAGTAATGATCCACACGGTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-413s1c1
Sequence:CCGGGCAGGGACTGTTTCAGCTATACTCGAGTATAGCTGAAACAGTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-1035s1c1
Sequence:CCGGGCCAGTTTCTATGAGGAGTATCTCGAGATACTCCTCATAGAAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-1469s1c1
Sequence:CCGGCCAGCAGATTATCTTCTACATCTCGAGATGTAGAAGATAATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173371.2-4329s1c1
Sequence:CCGGGCCTAGAATGTCCCGTTCTTACTCGAGTAAGAACGGGACATTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173371.2-2624s1c1
Sequence:CCGGGCTGGTTTGGTACATGGATTACTCGAGTAATCCATGTACCAAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-1468s21c1
Sequence:CCGGCCAGCAGATTATCTTCTACATCTCGAGATGTAGAAGATAATCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-1383s21c1
Sequence:CCGGGCTATGTTCGGATTGTGTTTACTCGAGTAAACACAATCCGAACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-412s21c1
Sequence:CCGGGCAGGGACTGTTTCAGCTATACTCGAGTATAGCTGAAACAGTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173371
VALIDATED
H6PD MISSION shRNA shRNA Plasmid DNA
hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173371.3-4328s21c1
Sequence:CCGGGCCTAGAATGTCCCGTTCTTACTCGAGTAAGAACGGGACATTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-877s21c1
Sequence:CCGGGATGTACCGTGTGGATCATTACTCGAGTAATGATCCACACGGTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-413s1c1
Sequence:CCGGGCAGGGACTGTTTCAGCTATACTCGAGTATAGCTGAAACAGTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-1035s1c1
Sequence:CCGGGCCAGTTTCTATGAGGAGTATCTCGAGATACTCCTCATAGAAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-1469s1c1
Sequence:CCGGCCAGCAGATTATCTTCTACATCTCGAGATGTAGAAGATAATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173371.2-4329s1c1
Sequence:CCGGGCCTAGAATGTCCCGTTCTTACTCGAGTAAGAACGGGACATTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173371.2-2624s1c1
Sequence:CCGGGCTGGTTTGGTACATGGATTACTCGAGTAATCCATGTACCAAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-1468s21c1
Sequence:CCGGCCAGCAGATTATCTTCTACATCTCGAGATGTAGAAGATAATCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-1383s21c1
Sequence:CCGGGCTATGTTCGGATTGTGTTTACTCGAGTAAACACAATCCGAACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-412s21c1
Sequence:CCGGGCAGGGACTGTTTCAGCTATACTCGAGTATAGCTGAAACAGTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173371
VALIDATED
H6PD MISSION shRNA Lentiviral Transduction Particles
hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173371.3-4328s21c1
Sequence:CCGGGCCTAGAATGTCCCGTTCTTACTCGAGTAAGAACGGGACATTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-877s21c1
Sequence:CCGGGATGTACCGTGTGGATCATTACTCGAGTAATGATCCACACGGTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-413s1c1
Sequence:CCGGGCAGGGACTGTTTCAGCTATACTCGAGTATAGCTGAAACAGTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-1035s1c1
Sequence:CCGGGCCAGTTTCTATGAGGAGTATCTCGAGATACTCCTCATAGAAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173371.2-1469s1c1
Sequence:CCGGCCAGCAGATTATCTTCTACATCTCGAGATGTAGAAGATAATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173371.2-4329s1c1
Sequence:CCGGGCCTAGAATGTCCCGTTCTTACTCGAGTAAGAACGGGACATTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173371.2-2624s1c1
Sequence:CCGGGCTGGTTTGGTACATGGATTACTCGAGTAATCCATGTACCAAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-1468s21c1
Sequence:CCGGCCAGCAGATTATCTTCTACATCTCGAGATGTAGAAGATAATCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-1383s21c1
Sequence:CCGGGCTATGTTCGGATTGTGTTTACTCGAGTAAACACAATCCGAACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173371.3-412s21c1
Sequence:CCGGGCAGGGACTGTTTCAGCTATACTCGAGTATAGCTGAAACAGTCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004285
VALIDATED
H6PD MISSION shRNA Bacterial Glycerol Stock
hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004285.3-4374s21c1
Sequence:CCGGCTCTGGATCAGGCAGATATAACTCGAGTTATATCTGCCTGATCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004285.1-1376s1c1
Sequence:CCGGCGCTCGGATCTTGTTCAAGAACTCGAGTTCTTGAACAAGATCCGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-1647s21c1
Sequence:CCGGCTCCGTCCTCTTATCCCATATCTCGAGATATGGGATAAGAGGACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-1796s1c1
Sequence:CCGGCCGTCTGTTGGACTTTGAGTTCTCGAGAACTCAAAGTCCAACAGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-708s1c1
Sequence:CCGGCCCTTCGCCTATGAAGACATTCTCGAGAATGTCTTCATAGGCGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-1959s1c1
Sequence:CCGGCTGATCTCTAAGCTGGCTAATCTCGAGATTAGCCAGCTTAGAGATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004285.1-978s1c1
Sequence:CCGGCGGGTGGAGATCATCATGAAACTCGAGTTTCATGATGATCTCCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-1793s21c1
Sequence:CCGGATGGCCGTCTGTTGGACTTTGCTCGAGCAAAGTCCAACAGACGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-872s21c1
Sequence:CCGGACCGGGTGGACCATTACTTAGCTCGAGCTAAGTAATGGTCCACCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004285
VALIDATED
H6PD MISSION shRNA shRNA Plasmid DNA
hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004285.3-4374s21c1
Sequence:CCGGCTCTGGATCAGGCAGATATAACTCGAGTTATATCTGCCTGATCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004285.1-1376s1c1
Sequence:CCGGCGCTCGGATCTTGTTCAAGAACTCGAGTTCTTGAACAAGATCCGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-1647s21c1
Sequence:CCGGCTCCGTCCTCTTATCCCATATCTCGAGATATGGGATAAGAGGACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-1796s1c1
Sequence:CCGGCCGTCTGTTGGACTTTGAGTTCTCGAGAACTCAAAGTCCAACAGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-708s1c1
Sequence:CCGGCCCTTCGCCTATGAAGACATTCTCGAGAATGTCTTCATAGGCGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-1959s1c1
Sequence:CCGGCTGATCTCTAAGCTGGCTAATCTCGAGATTAGCCAGCTTAGAGATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004285.1-978s1c1
Sequence:CCGGCGGGTGGAGATCATCATGAAACTCGAGTTTCATGATGATCTCCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-1793s21c1
Sequence:CCGGATGGCCGTCTGTTGGACTTTGCTCGAGCAAAGTCCAACAGACGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-872s21c1
Sequence:CCGGACCGGGTGGACCATTACTTAGCTCGAGCTAAGTAATGGTCCACCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004285
VALIDATED
H6PD MISSION shRNA Lentiviral Transduction Particles
hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004285.3-4374s21c1
Sequence:CCGGCTCTGGATCAGGCAGATATAACTCGAGTTATATCTGCCTGATCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004285.1-1376s1c1
Sequence:CCGGCGCTCGGATCTTGTTCAAGAACTCGAGTTCTTGAACAAGATCCGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-1647s21c1
Sequence:CCGGCTCCGTCCTCTTATCCCATATCTCGAGATATGGGATAAGAGGACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-1796s1c1
Sequence:CCGGCCGTCTGTTGGACTTTGAGTTCTCGAGAACTCAAAGTCCAACAGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-708s1c1
Sequence:CCGGCCCTTCGCCTATGAAGACATTCTCGAGAATGTCTTCATAGGCGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004285.1-1959s1c1
Sequence:CCGGCTGATCTCTAAGCTGGCTAATCTCGAGATTAGCCAGCTTAGAGATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004285.1-978s1c1
Sequence:CCGGCGGGTGGAGATCATCATGAAACTCGAGTTTCATGATGATCTCCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-1793s21c1
Sequence:CCGGATGGCCGTCTGTTGGACTTTGCTCGAGCAAAGTCCAACAGACGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004285.3-872s21c1
Sequence:CCGGACCGGGTGGACCATTACTTAGCTCGAGCTAAGTAATGGTCCACCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)