EMAIL THIS PAGE TO A FRIEND

HAAO

3-hydroxyanthranilate 3,4-dioxygenase

93 Gene Product Result for
Synonyms: 3-HAO HAO
UniProtKB ID: P46952, A6NE56, B4DIN2, Q53QZ7, Q8N6N9
Gene ID:
Human(23498) Summary: 3-Hydroxyanthranilate 3,4-dioxygenase is a monomeric cytosolic protein belonging to the family of intramolecular dioxygenases containing nonheme ferrous iron. It is widely distributed in peripheral organs, such as liver and kidney, and is also present in low amounts in the central nervous system. HAAO catalyzes the synthesis of quinolinic acid (QUIN) from 3-hydroxyanthranilic acid. QUIN is an excitotoxin whose toxicity is mediated by its ability to activate glutamate N-methyl-D-aspartate receptors. Increased cerebral levels of QUIN may participate in the pathogenesis of neurologic and inflammatory disorders. HAAO has been suggested to play a role in disorders associated with altered tissue levels of QUIN. [provided by RefSeq, Jul 2008]
Mouse(107766) 3-hydroxyanthranilate 3,4-dioxygenase
Rat(56823) 3-hydroxyanthranilate 3,4-dioxygenase
Zebrafish(492518) 3-hydroxyanthranilate 3,4-dioxygenase
cow(510602) 3-hydroxyanthranilate 3,4-dioxygenase
domestic cat(101092928) 3-hydroxyanthranilate 3,4-dioxygenase
dog(611728) 3-hydroxyanthranilate 3,4-dioxygenase
chicken(421396) 3-hydroxyanthranilate 3,4-dioxygenase
sheep(101115197) 3-hydroxyanthranilate 3,4-dioxygenase
domestic guinea pig(100718413) 3-hydroxyanthranilate 3,4-dioxygenase
naked mole-rat(101717713) 3-hydroxyanthranilate 3,4-dioxygenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012205 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012205 Rosetta Predictions human pricing
NM_020076 Rosetta Predictions rat pricing
NM_025325 Rosetta Predictions mouse pricing
XM_354652 Rosetta Predictions mouse pricing
XM_890647 Rosetta Predictions mouse pricing
XM_899123 Rosetta Predictions mouse pricing
XM_899160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153961 predicted 441
2 SASI_Hs01_00153962 predicted 1047
3 SASI_Hs02_00343859 predicted 198
4 SASI_Hs01_00153965 predicted 440
5 SASI_Hs01_00153966 predicted 292
6 SASI_Hs01_00153967 predicted 472
7 SASI_Hs02_00343860 predicted 341
8 SASI_Hs01_00153968 predicted 854
9 SASI_Hs01_00153969 predicted 549
10 SASI_Hs01_00153970 predicted 696
11 SASI_Hs01_00153963 predicted 263
12 SASI_Hs01_00153964 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092383 predicted 534
2 SASI_Rn02_00262478 predicted 739
3 SASI_Rn01_00092384 predicted 602
4 SASI_Rn01_00092385 predicted 1030
5 SASI_Rn01_00092387 predicted 726
6 SASI_Rn01_00092389 predicted 665
7 SASI_Rn02_00262479 predicted 366
8 SASI_Rn01_00092390 predicted 451
9 SASI_Rn01_00092391 predicted 612
10 SASI_Rn01_00092392 predicted 677
11 SASI_Rn01_00092386 predicted 1006
12 SASI_Rn01_00092388 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327963 predicted 402
2 SASI_Mm02_00327964 predicted 439
3 SASI_Mm02_00327965 predicted 583
4 SASI_Mm02_00327966 predicted 571
5 SASI_Mm02_00327967 predicted 438
6 SASI_Mm02_00327968 predicted 298
7 SASI_Mm02_00327969 predicted 282
8 SASI_Mm02_00327970 predicted 660
9 SASI_Mm02_00327971 predicted 845
10 SASI_Mm02_00327972 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_354652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245015 predicted 478
2 SASI_Mm01_00245016 predicted 511
3 SASI_Mm01_00245017 predicted 653
4 SASI_Mm01_00245018 predicted 820
5 SASI_Mm01_00245019 predicted 638
6 SASI_Mm01_00245020 predicted 508
7 SASI_Mm01_00245021 predicted 724
8 SASI_Mm01_00245022 predicted 1070
9 SASI_Mm01_00245023 predicted 913
10 SASI_Mm01_00245024 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216104 predicted 518
2 SASI_Mm01_00216105 predicted 546
3 SASI_Mm01_00216106 predicted 693
4 SASI_Mm01_00216107 predicted 861
5 SASI_Mm01_00216108 predicted 678
6 SASI_Mm01_00216109 predicted 556
7 SASI_Mm01_00216110 predicted 410
8 SASI_Mm01_00216111 predicted 393
9 SASI_Mm01_00216112 predicted 946
10 SASI_Mm01_00216113 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899123 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238532 predicted 1858
2 SASI_Mm01_00238533 predicted 1894
3 SASI_Mm01_00238534 predicted 1261
4 SASI_Mm01_00238535 predicted 1667
5 SASI_Mm01_00238536 predicted 1560
6 SASI_Mm01_00238537 predicted 1234
7 SASI_Mm01_00238538 predicted 1948
8 SASI_Mm01_00238539 predicted 1558
9 SASI_Mm01_00238540 predicted 1908
10 SASI_Mm01_00238541 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229715 predicted 518
2 SASI_Mm01_00229716 predicted 552
3 SASI_Mm01_00229717 predicted 700
4 SASI_Mm01_00229718 predicted 866
5 SASI_Mm01_00229719 predicted 692
6 SASI_Mm01_00229720 predicted 556
7 SASI_Mm01_00229721 predicted 413
8 SASI_Mm01_00229722 predicted 400
9 SASI_Mm01_00229723 predicted 961
10 SASI_Mm01_00229724 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025325
HAAO MISSION shRNA Bacterial Glycerol Stock
3-hydroxyanthranilate 3,4-dioxygenase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-691s21c1
Sequence:CCGGGCTATGAGACCCAGGTCATTGCTCGAGCAATGACCTGGGTCTCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-134s21c1
Sequence:CCGGTCCGGTTTGCAACAAGCTTATCTCGAGATAAGCTTGTTGCAAACCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-303s21c1
Sequence:CCGGATACGGCAGGGAGAGATATTCCTCGAGGAATATCTCTCCCTGCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-574s21c1
Sequence:CCGGAGCTGCCATTCCCGCTGAATACTCGAGTATTCAGCGGGAATGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-193s21c1
Sequence:CCGGCCAATACCAGGAAGGATTATCCTCGAGGATAATCCTTCCTGGTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-793s21c1
Sequence:CCGGCAATGGGAGGGCAGTGTATAGCTCGAGCTATACACTGCCCTCCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-603s21c1
Sequence:CCGGATCATGAAGCCCATGTCATTGCTCGAGCAATGACATGGGCTTCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025325.2-1021s21c1
Sequence:CCGGATTGCATCTCCATGGACATCACTCGAGTGATGTCCATGGAGATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025325.2-979s21c1
Sequence:CCGGTGACCTGGTAGCTGCCCATTTCTCGAGAAATGGGCAGCTACCAGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-244s21c1
Sequence:CCGGAGCTGGAGGGAGACATGATACCTCGAGGTATCATGTCTCCCTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025325
HAAO MISSION shRNA shRNA Plasmid DNA
3-hydroxyanthranilate 3,4-dioxygenase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-691s21c1
Sequence:CCGGGCTATGAGACCCAGGTCATTGCTCGAGCAATGACCTGGGTCTCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-134s21c1
Sequence:CCGGTCCGGTTTGCAACAAGCTTATCTCGAGATAAGCTTGTTGCAAACCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-303s21c1
Sequence:CCGGATACGGCAGGGAGAGATATTCCTCGAGGAATATCTCTCCCTGCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-574s21c1
Sequence:CCGGAGCTGCCATTCCCGCTGAATACTCGAGTATTCAGCGGGAATGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-193s21c1
Sequence:CCGGCCAATACCAGGAAGGATTATCCTCGAGGATAATCCTTCCTGGTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-793s21c1
Sequence:CCGGCAATGGGAGGGCAGTGTATAGCTCGAGCTATACACTGCCCTCCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-603s21c1
Sequence:CCGGATCATGAAGCCCATGTCATTGCTCGAGCAATGACATGGGCTTCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025325.2-1021s21c1
Sequence:CCGGATTGCATCTCCATGGACATCACTCGAGTGATGTCCATGGAGATGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025325.2-979s21c1
Sequence:CCGGTGACCTGGTAGCTGCCCATTTCTCGAGAAATGGGCAGCTACCAGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-244s21c1
Sequence:CCGGAGCTGGAGGGAGACATGATACCTCGAGGTATCATGTCTCCCTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025325
HAAO MISSION shRNA Lentiviral Transduction Particles
3-hydroxyanthranilate 3,4-dioxygenase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-691s21c1
Sequence:CCGGGCTATGAGACCCAGGTCATTGCTCGAGCAATGACCTGGGTCTCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-134s21c1
Sequence:CCGGTCCGGTTTGCAACAAGCTTATCTCGAGATAAGCTTGTTGCAAACCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-303s21c1
Sequence:CCGGATACGGCAGGGAGAGATATTCCTCGAGGAATATCTCTCCCTGCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-574s21c1
Sequence:CCGGAGCTGCCATTCCCGCTGAATACTCGAGTATTCAGCGGGAATGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-193s21c1
Sequence:CCGGCCAATACCAGGAAGGATTATCCTCGAGGATAATCCTTCCTGGTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-793s21c1
Sequence:CCGGCAATGGGAGGGCAGTGTATAGCTCGAGCTATACACTGCCCTCCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-603s21c1
Sequence:CCGGATCATGAAGCCCATGTCATTGCTCGAGCAATGACATGGGCTTCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025325.2-1021s21c1
Sequence:CCGGATTGCATCTCCATGGACATCACTCGAGTGATGTCCATGGAGATGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025325.2-979s21c1
Sequence:CCGGTGACCTGGTAGCTGCCCATTTCTCGAGAAATGGGCAGCTACCAGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025325.2-244s21c1
Sequence:CCGGAGCTGGAGGGAGACATGATACCTCGAGGTATCATGTCTCCCTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012205
HAAO MISSION shRNA Bacterial Glycerol Stock
3-hydroxyanthranilate 3,4-dioxygenase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-185s1c1
Sequence:CCGGGAAGAGGGTGAAGAGGTATTTCTCGAGAAATACCTCTTCACCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-100s1c1
Sequence:CCGGCCCGGTCTGCAACAAGCTCATCTCGAGATGAGCTTGTTGCAGACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-415s1c1
Sequence:CCGGCGTTCTGTTTGAGAAGTGGTTCTCGAGAACCACTTCTCAAACAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-233s1c1
Sequence:CCGGCGAGTCCTGGAGCAAGGGAAACTCGAGTTTCCCTTGCTCCAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-492s1c1
Sequence:CCGGCTGAGCAGTACAGAACAGGAACTCGAGTTCCTGTTCTGTACTGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012205
HAAO MISSION shRNA shRNA Plasmid DNA
3-hydroxyanthranilate 3,4-dioxygenase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-185s1c1
Sequence:CCGGGAAGAGGGTGAAGAGGTATTTCTCGAGAAATACCTCTTCACCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-100s1c1
Sequence:CCGGCCCGGTCTGCAACAAGCTCATCTCGAGATGAGCTTGTTGCAGACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-415s1c1
Sequence:CCGGCGTTCTGTTTGAGAAGTGGTTCTCGAGAACCACTTCTCAAACAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-233s1c1
Sequence:CCGGCGAGTCCTGGAGCAAGGGAAACTCGAGTTTCCCTTGCTCCAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-492s1c1
Sequence:CCGGCTGAGCAGTACAGAACAGGAACTCGAGTTCCTGTTCTGTACTGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012205
HAAO MISSION shRNA Lentiviral Transduction Particles
3-hydroxyanthranilate 3,4-dioxygenase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-185s1c1
Sequence:CCGGGAAGAGGGTGAAGAGGTATTTCTCGAGAAATACCTCTTCACCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-100s1c1
Sequence:CCGGCCCGGTCTGCAACAAGCTCATCTCGAGATGAGCTTGTTGCAGACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-415s1c1
Sequence:CCGGCGTTCTGTTTGAGAAGTGGTTCTCGAGAACCACTTCTCAAACAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-233s1c1
Sequence:CCGGCGAGTCCTGGAGCAAGGGAAACTCGAGTTTCCCTTGCTCCAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012205.1-492s1c1
Sequence:CCGGCTGAGCAGTACAGAACAGGAACTCGAGTTCCTGTTCTGTACTGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)