EMAIL THIS PAGE TO A FRIEND

HABP2

hyaluronan binding protein 2

108 Gene Product Result for
Synonyms: FSAP HABP HGFAL PHBP
UniProtKB ID: Q14520, A8K467, B7Z8U5, F5H5M6, O00663
Gene ID:
Human(3026) Summary: The protein encoded by this gene is an extracellular serine protease that binds hyaluronic acid and is involved in cell adhesion. The encoded protein is synthesized as a single chain, but then undergoes an autoproteolytic event to form the functional heterodimer. Further autoproteolysis leads to smaller, inactive peptides. This protease is known to cleave urinary plasminogen activator, coagulation factor VII, and the alpha and beta chains of fibrinogen, but not prothrombin, plasminogen, or the gamma chain of fibrinogen. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(226243) hyaluronic acid binding protein 2
Rat(292126) hyaluronan binding protein 2
Zebrafish(553472) hyaluronan binding protein 2
cow(507993) hyaluronan binding protein 2
Horse(100068293) hyaluronan binding protein 2
domestic cat(101080665) hyaluronan binding protein 2
chicken(423898) hyaluronan binding protein 2
dog(477822) hyaluronan binding protein 2
domestic guinea pig(100715439) hyaluronan binding protein 2
naked mole-rat(101708951) hyaluronan binding protein 2
sheep(101122483) hyaluronan binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004132 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051611 MISSION® esiRNA esiRNA human HABP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004132 Rosetta Predictions human pricing
NM_001001505 Rosetta Predictions rat pricing
NM_146101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078432 predicted 1659
2 SASI_Hs01_00078433 predicted 654
3 SASI_Hs01_00078434 predicted 491
4 SASI_Hs01_00078435 predicted 1378
5 SASI_Hs01_00078437 predicted 696
6 SASI_Hs01_00078438 predicted 682
7 SASI_Hs01_00078439 predicted 1732
8 SASI_Hs01_00078440 predicted 1328
9 SASI_Hs01_00078441 predicted 1002
10 SASI_Hs02_00336983 predicted 404
11 SASI_Hs01_00078436 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00197902 predicted 569
2 SASI_Rn01_00089356 predicted 1565
3 SASI_Rn02_00197903 predicted 1205
4 SASI_Rn01_00089358 predicted 1783
5 SASI_Rn01_00089359 predicted 1644
6 SASI_Rn01_00089360 predicted 1413
7 SASI_Rn01_00089361 predicted 1577
8 SASI_Rn01_00089362 predicted 1769
9 SASI_Rn01_00089363 predicted 291
10 SASI_Rn01_00089365 predicted 690
11 SASI_Rn01_00089357 predicted 1566
12 SASI_Rn01_00089364 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143237 predicted 1554
2 SASI_Mm01_00143238 predicted 1321
3 SASI_Mm01_00143239 predicted 1114
4 SASI_Mm01_00143241 predicted 1333
5 SASI_Mm01_00143242 predicted 475
6 SASI_Mm01_00143243 predicted 726
7 SASI_Mm01_00143244 predicted 1521
8 SASI_Mm01_00143245 predicted 294
9 SASI_Mm01_00143246 predicted 1478
10 SASI_Mm02_00341745 predicted 521
11 SASI_Mm01_00143240 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146101
VALIDATED
HABP2 MISSION shRNA Bacterial Glycerol Stock
hyaluronan binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146101.1-1811s1c1
Sequence:CCGGCCGTTCTGACAAGTGTACCTTCTCGAGAAGGTACACTTGTCAGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-703s1c1
Sequence:CCGGCGTCAAGGTGAACAGTGAGAACTCGAGTTCTCACTGTTCACCTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-601s1c1
Sequence:CCGGGCAGGAGACTTATAACATGTTCTCGAGAACATGTTATAAGTCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-1318s1c1
Sequence:CCGGGCTCCTGGATGCTAAAGTCAACTCGAGTTGACTTTAGCATCCAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146101.1-503s1c1
Sequence:CCGGGACGACTGTTATGTCGGTGATCTCGAGATCACCGACATAACAGTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146101.1-1811s21c1
Sequence:CCGGCCGTTCTGACAAGTGTACCTTCTCGAGAAGGTACACTTGTCAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-703s21c1
Sequence:CCGGCGTCAAGGTGAACAGTGAGAACTCGAGTTCTCACTGTTCACCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-1318s21c1
Sequence:CCGGGCTCCTGGATGCTAAAGTCAACTCGAGTTGACTTTAGCATCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-601s21c1
Sequence:CCGGGCAGGAGACTTATAACATGTTCTCGAGAACATGTTATAAGTCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146101
VALIDATED
HABP2 MISSION shRNA shRNA Plasmid DNA
hyaluronan binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146101.1-1811s1c1
Sequence:CCGGCCGTTCTGACAAGTGTACCTTCTCGAGAAGGTACACTTGTCAGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-703s1c1
Sequence:CCGGCGTCAAGGTGAACAGTGAGAACTCGAGTTCTCACTGTTCACCTTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-601s1c1
Sequence:CCGGGCAGGAGACTTATAACATGTTCTCGAGAACATGTTATAAGTCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-1318s1c1
Sequence:CCGGGCTCCTGGATGCTAAAGTCAACTCGAGTTGACTTTAGCATCCAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146101.1-503s1c1
Sequence:CCGGGACGACTGTTATGTCGGTGATCTCGAGATCACCGACATAACAGTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146101.1-1811s21c1
Sequence:CCGGCCGTTCTGACAAGTGTACCTTCTCGAGAAGGTACACTTGTCAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-703s21c1
Sequence:CCGGCGTCAAGGTGAACAGTGAGAACTCGAGTTCTCACTGTTCACCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-1318s21c1
Sequence:CCGGGCTCCTGGATGCTAAAGTCAACTCGAGTTGACTTTAGCATCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-601s21c1
Sequence:CCGGGCAGGAGACTTATAACATGTTCTCGAGAACATGTTATAAGTCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146101
VALIDATED
HABP2 MISSION shRNA Lentiviral Transduction Particles
hyaluronan binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146101.1-1811s1c1
Sequence:CCGGCCGTTCTGACAAGTGTACCTTCTCGAGAAGGTACACTTGTCAGAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-703s1c1
Sequence:CCGGCGTCAAGGTGAACAGTGAGAACTCGAGTTCTCACTGTTCACCTTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-601s1c1
Sequence:CCGGGCAGGAGACTTATAACATGTTCTCGAGAACATGTTATAAGTCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146101.1-1318s1c1
Sequence:CCGGGCTCCTGGATGCTAAAGTCAACTCGAGTTGACTTTAGCATCCAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146101.1-503s1c1
Sequence:CCGGGACGACTGTTATGTCGGTGATCTCGAGATCACCGACATAACAGTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146101.1-1811s21c1
Sequence:CCGGCCGTTCTGACAAGTGTACCTTCTCGAGAAGGTACACTTGTCAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-703s21c1
Sequence:CCGGCGTCAAGGTGAACAGTGAGAACTCGAGTTCTCACTGTTCACCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-1318s21c1
Sequence:CCGGGCTCCTGGATGCTAAAGTCAACTCGAGTTGACTTTAGCATCCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146101.1-601s21c1
Sequence:CCGGGCAGGAGACTTATAACATGTTCTCGAGAACATGTTATAAGTCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004132
HABP2 MISSION shRNA Bacterial Glycerol Stock
hyaluronan binding protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004132.2-2486s1c1
Sequence:CCGGCCGCTGCTGAAATCAAACATACTCGAGTATGTTTGATTTCAGCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1231s1c1
Sequence:CCGGGACCTGAAGAAAGAAGAATTTCTCGAGAAATTCTTCTTTCTTCAGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-406s1c1
Sequence:CCGGTCTGGGAATAAGTGTCAGAAACTCGAGTTTCTGACACTTATTCCCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1719s1c1
Sequence:CCGGCCAAGTTACCAAATTCCTGAACTCGAGTTCAGGAATTTGGTAACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1536s1c1
Sequence:CCGGCCAACTCTATGACCACATGATCTCGAGATCATGTGGTCATAGAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-231s21c1
Sequence:CCGGATTACAGCTACGAGGATTATACTCGAGTATAATCCTCGTAGCTGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-1656s21c1
Sequence:CCGGACGGCACCTACTACGTCTATGCTCGAGCATAGACGTAGTAGGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-1183s21c1
Sequence:CCGGTGCCCACTGCACCGACATAAACTCGAGTTTATGTCGGTGCAGTGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004132
HABP2 MISSION shRNA shRNA Plasmid DNA
hyaluronan binding protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004132.2-2486s1c1
Sequence:CCGGCCGCTGCTGAAATCAAACATACTCGAGTATGTTTGATTTCAGCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1231s1c1
Sequence:CCGGGACCTGAAGAAAGAAGAATTTCTCGAGAAATTCTTCTTTCTTCAGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-406s1c1
Sequence:CCGGTCTGGGAATAAGTGTCAGAAACTCGAGTTTCTGACACTTATTCCCAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1719s1c1
Sequence:CCGGCCAAGTTACCAAATTCCTGAACTCGAGTTCAGGAATTTGGTAACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1536s1c1
Sequence:CCGGCCAACTCTATGACCACATGATCTCGAGATCATGTGGTCATAGAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-231s21c1
Sequence:CCGGATTACAGCTACGAGGATTATACTCGAGTATAATCCTCGTAGCTGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-1656s21c1
Sequence:CCGGACGGCACCTACTACGTCTATGCTCGAGCATAGACGTAGTAGGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-1183s21c1
Sequence:CCGGTGCCCACTGCACCGACATAAACTCGAGTTTATGTCGGTGCAGTGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004132
HABP2 MISSION shRNA Lentiviral Transduction Particles
hyaluronan binding protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004132.2-2486s1c1
Sequence:CCGGCCGCTGCTGAAATCAAACATACTCGAGTATGTTTGATTTCAGCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1231s1c1
Sequence:CCGGGACCTGAAGAAAGAAGAATTTCTCGAGAAATTCTTCTTTCTTCAGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-406s1c1
Sequence:CCGGTCTGGGAATAAGTGTCAGAAACTCGAGTTTCTGACACTTATTCCCAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1719s1c1
Sequence:CCGGCCAAGTTACCAAATTCCTGAACTCGAGTTCAGGAATTTGGTAACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004132.2-1536s1c1
Sequence:CCGGCCAACTCTATGACCACATGATCTCGAGATCATGTGGTCATAGAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-231s21c1
Sequence:CCGGATTACAGCTACGAGGATTATACTCGAGTATAATCCTCGTAGCTGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-1656s21c1
Sequence:CCGGACGGCACCTACTACGTCTATGCTCGAGCATAGACGTAGTAGGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004132.3-1183s21c1
Sequence:CCGGTGCCCACTGCACCGACATAAACTCGAGTTTATGTCGGTGCAGTGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)