EMAIL THIS PAGE TO A FRIEND

HABP4

hyaluronan binding protein 4

49 Gene Product Result for
Synonyms: IHABP4 Ki-1/57 SERBP1L
UniProtKB ID: Q5JVS0, O75804, Q8WV33, Q9NYJ2
Gene ID:
Mouse(56541) hyaluronic acid binding protein 4
Rat(361196) hyaluronan binding protein 4
sheep(101113133) hyaluronan binding protein 4
domestic guinea pig(100718942) hyaluronan binding protein 4
naked mole-rat(101714371) hyaluronan binding protein 4
chicken(395444) hyaluronan binding protein 4
domestic cat(101089654) hyaluronan binding protein 4
dog(484133) hyaluronan binding protein 4
cow(514807) hyaluronan binding protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014282 Rosetta Predictions human pricing
NM_001079940 Rosetta Predictions rat pricing
NM_019986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036416 predicted 832
2 SASI_Hs02_00345359 predicted 660
3 SASI_Hs01_00036418 predicted 1156
4 SASI_Hs02_00345360 predicted 1061
5 SASI_Hs01_00036420 predicted 1002
6 SASI_Hs01_00036421 predicted 1195
7 SASI_Hs01_00036422 predicted 1050
8 SASI_Hs01_00036423 predicted 1361
9 SASI_Hs01_00036424 predicted 1353
10 SASI_Hs02_00345361 predicted 593
11 SASI_Hs01_00036417 predicted 1429
12 SASI_Hs01_00036419 predicted 704
13 SASI_Hs01_00036425 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208349 predicted 1107
2 SASI_Rn02_00208350 predicted 561
3 SASI_Rn02_00208351 predicted 558
4 SASI_Rn02_00208352 predicted 1047
5 SASI_Rn02_00208353 predicted 1112
6 SASI_Rn02_00208354 predicted 549
7 SASI_Rn02_00208355 predicted 450
8 SASI_Rn02_00208356 predicted 1097
9 SASI_Rn02_00208357 predicted 732
10 SASI_Rn02_00208358 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165834 predicted 772
2 SASI_Mm02_00325327 predicted 983
3 SASI_Mm01_00165835 predicted 759
4 SASI_Mm01_00165836 predicted 1391
5 SASI_Mm01_00165837 predicted 1456
6 SASI_Mm01_00165838 predicted 1421
7 SASI_Mm01_00165839 predicted 747
8 SASI_Mm01_00165840 predicted 841
9 SASI_Mm02_00325328 predicted 1120
10 SASI_Mm01_00165842 predicted 565
11 SASI_Mm01_00165841 predicted 1105
12 SASI_Mm01_00165843 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014282
VALIDATED
HABP4 MISSION shRNA Bacterial Glycerol Stock
hyaluronan binding protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1108s21c1
Sequence:CCGGCAAAGCCGTGGTGATTCACAACTCGAGTTGTGAATCACCACGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-710s1c1
Sequence:CCGGGAAAGCGAGAATTTGAAAGATCTCGAGATCTTTCAAATTCTCGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-934s1c1
Sequence:CCGGCAAGTTCAAGAGATGACTTTACTCGAGTAAAGTCATCTCTTGAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-1249s1c1
Sequence:CCGGGCAGAAGTGGTGATGCAAGATCTCGAGATCTTGCATCACCACTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014282.1-983s1c1
Sequence:CCGGCCAGACCAAAGCCTGAGTTTACTCGAGTAAACTCAGGCTTTGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014282.1-1228s1c1
Sequence:CCGGGCAGAGAACAACTATCCCAGACTCGAGTCTGGGATAGTTGTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1210s21c1
Sequence:CCGGATCCCAGCTGGAGATTAATTTCTCGAGAAATTAATCTCCAGCTGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1373s21c1
Sequence:CCGGTTCCCTGCGCTGTCTTGAAAGCTCGAGCTTTCAAGACAGCGCAGGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014282.1-1503s1c1
Sequence:CCGGCCCAAGAAGATGAAGAATGGTCTCGAGACCATTCTTCATCTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014282
VALIDATED
HABP4 MISSION shRNA shRNA Plasmid DNA
hyaluronan binding protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1108s21c1
Sequence:CCGGCAAAGCCGTGGTGATTCACAACTCGAGTTGTGAATCACCACGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-710s1c1
Sequence:CCGGGAAAGCGAGAATTTGAAAGATCTCGAGATCTTTCAAATTCTCGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-934s1c1
Sequence:CCGGCAAGTTCAAGAGATGACTTTACTCGAGTAAAGTCATCTCTTGAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-1249s1c1
Sequence:CCGGGCAGAAGTGGTGATGCAAGATCTCGAGATCTTGCATCACCACTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014282.1-983s1c1
Sequence:CCGGCCAGACCAAAGCCTGAGTTTACTCGAGTAAACTCAGGCTTTGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014282.1-1228s1c1
Sequence:CCGGGCAGAGAACAACTATCCCAGACTCGAGTCTGGGATAGTTGTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1210s21c1
Sequence:CCGGATCCCAGCTGGAGATTAATTTCTCGAGAAATTAATCTCCAGCTGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1373s21c1
Sequence:CCGGTTCCCTGCGCTGTCTTGAAAGCTCGAGCTTTCAAGACAGCGCAGGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014282.1-1503s1c1
Sequence:CCGGCCCAAGAAGATGAAGAATGGTCTCGAGACCATTCTTCATCTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014282
VALIDATED
HABP4 MISSION shRNA Lentiviral Transduction Particles
hyaluronan binding protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1108s21c1
Sequence:CCGGCAAAGCCGTGGTGATTCACAACTCGAGTTGTGAATCACCACGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-710s1c1
Sequence:CCGGGAAAGCGAGAATTTGAAAGATCTCGAGATCTTTCAAATTCTCGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-934s1c1
Sequence:CCGGCAAGTTCAAGAGATGACTTTACTCGAGTAAAGTCATCTCTTGAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014282.1-1249s1c1
Sequence:CCGGGCAGAAGTGGTGATGCAAGATCTCGAGATCTTGCATCACCACTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014282.1-983s1c1
Sequence:CCGGCCAGACCAAAGCCTGAGTTTACTCGAGTAAACTCAGGCTTTGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014282.1-1228s1c1
Sequence:CCGGGCAGAGAACAACTATCCCAGACTCGAGTCTGGGATAGTTGTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1210s21c1
Sequence:CCGGATCCCAGCTGGAGATTAATTTCTCGAGAAATTAATCTCCAGCTGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014282.2-1373s21c1
Sequence:CCGGTTCCCTGCGCTGTCTTGAAAGCTCGAGCTTTCAAGACAGCGCAGGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014282.1-1503s1c1
Sequence:CCGGCCCAAGAAGATGAAGAATGGTCTCGAGACCATTCTTCATCTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019986
VALIDATED
HABP4 MISSION shRNA Bacterial Glycerol Stock
hyaluronan binding protein 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019986.1-1820s1c1
Sequence:CCGGGCAGAGGAAGTGTACTGGTTTCTCGAGAAACCAGTACACTTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019986.3-771s1c1
Sequence:CCGGGAGATACAGTAGCAATGATAACTCGAGTTATCATTGCTACTGTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-603s21c1
Sequence:CCGGCTTGCCAGTGGAGAAGTTTACCTCGAGGTAAACTTCTCCACTGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-1176s21c1
Sequence:CCGGCACATCCCAGCTGGAGATTAACTCGAGTTAATCTCCAGCTGGGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-1030s21c1
Sequence:CCGGCCAAAGCCTGAGTTCAATATTCTCGAGAATATTGAACTCAGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019986.3-1099s21c1
Sequence:CCGGTCCAGATACAGAGACGATATGCTCGAGCATATCGTCTCTGTATCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019986.3-2307s21c1
Sequence:CCGGGTTGGGCAGCTGTCGAGATTACTCGAGTAATCTCGACAGCTGCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019986.1-1352s1c1
Sequence:CCGGGCGAGAAGAGTCAGACTCTAACTCGAGTTAGAGTCTGACTCTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019986
VALIDATED
HABP4 MISSION shRNA shRNA Plasmid DNA
hyaluronan binding protein 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019986.1-1820s1c1
Sequence:CCGGGCAGAGGAAGTGTACTGGTTTCTCGAGAAACCAGTACACTTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019986.3-771s1c1
Sequence:CCGGGAGATACAGTAGCAATGATAACTCGAGTTATCATTGCTACTGTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-603s21c1
Sequence:CCGGCTTGCCAGTGGAGAAGTTTACCTCGAGGTAAACTTCTCCACTGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-1176s21c1
Sequence:CCGGCACATCCCAGCTGGAGATTAACTCGAGTTAATCTCCAGCTGGGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-1030s21c1
Sequence:CCGGCCAAAGCCTGAGTTCAATATTCTCGAGAATATTGAACTCAGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019986.3-1099s21c1
Sequence:CCGGTCCAGATACAGAGACGATATGCTCGAGCATATCGTCTCTGTATCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019986.3-2307s21c1
Sequence:CCGGGTTGGGCAGCTGTCGAGATTACTCGAGTAATCTCGACAGCTGCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019986.1-1352s1c1
Sequence:CCGGGCGAGAAGAGTCAGACTCTAACTCGAGTTAGAGTCTGACTCTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019986
VALIDATED
HABP4 MISSION shRNA Lentiviral Transduction Particles
hyaluronan binding protein 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019986.1-1820s1c1
Sequence:CCGGGCAGAGGAAGTGTACTGGTTTCTCGAGAAACCAGTACACTTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019986.3-771s1c1
Sequence:CCGGGAGATACAGTAGCAATGATAACTCGAGTTATCATTGCTACTGTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-603s21c1
Sequence:CCGGCTTGCCAGTGGAGAAGTTTACCTCGAGGTAAACTTCTCCACTGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-1176s21c1
Sequence:CCGGCACATCCCAGCTGGAGATTAACTCGAGTTAATCTCCAGCTGGGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019986.3-1030s21c1
Sequence:CCGGCCAAAGCCTGAGTTCAATATTCTCGAGAATATTGAACTCAGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_019986.3-1099s21c1
Sequence:CCGGTCCAGATACAGAGACGATATGCTCGAGCATATCGTCTCTGTATCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249878    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019986.3-2307s21c1
Sequence:CCGGGTTGGGCAGCTGTCGAGATTACTCGAGTAATCTCGACAGCTGCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019986.1-1352s1c1
Sequence:CCGGGCGAGAAGAGTCAGACTCTAACTCGAGTTAGAGTCTGACTCTTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)