EMAIL THIS PAGE TO A FRIEND

HACE1

HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1

110 Gene Product Result for
Gene ID:
Mouse(209462) HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Rat(361866) HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Zebrafish(572430) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
domestic cat(101095417) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
cow(527565) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Horse(100071887) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
dog(475010) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
chicken(421788) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
domestic guinea pig(100733867) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
naked mole-rat(101705600) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
sheep(101121941) HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020771 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020771 Rosetta Predictions human pricing
NM_001108539 Rosetta Predictions rat pricing
NM_172473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232238 predicted 1679
2 SASI_Hs01_00232239 predicted 2908
3 SASI_Hs01_00232240 predicted 968
4 SASI_Hs01_00232241 predicted 920
5 SASI_Hs02_00353904 predicted 1349
6 SASI_Hs01_00232242 predicted 2206
7 SASI_Hs02_00353905 predicted 1587
8 SASI_Hs01_00232243 predicted 1216
9 SASI_Hs01_00232244 predicted 2499
10 SASI_Hs01_00232245 predicted 2152
11 SASI_Hs01_00232237 predicted 922
12 SASI_Hs01_00232246 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239639 predicted 2108
2 SASI_Rn02_00239640 predicted 2143
3 SASI_Rn02_00239641 predicted 1900
4 SASI_Rn02_00239642 predicted 1279
5 SASI_Rn02_00239643 predicted 1942
6 SASI_Rn02_00239644 predicted 639
7 SASI_Rn02_00239645 predicted 1997
8 SASI_Rn02_00239646 predicted 1205
9 SASI_Rn02_00239647 predicted 2580
10 SASI_Rn02_00239648 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021173 predicted 2824
2 SASI_Mm01_00021175 predicted 1584
3 SASI_Mm01_00021176 predicted 2408
4 SASI_Mm01_00021177 predicted 1210
5 SASI_Mm01_00021179 predicted 2393
6 SASI_Mm01_00021180 predicted 954
7 SASI_Mm02_00344025 predicted 2093
8 SASI_Mm02_00344026 predicted 1719
9 SASI_Mm01_00021181 predicted 911
10 SASI_Mm02_00344027 predicted 1189
11 SASI_Mm01_00021172 predicted 1709
12 SASI_Mm01_00021174 predicted 2095
13 SASI_Mm01_00021178 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172473
VALIDATED
HACE1 MISSION shRNA Bacterial Glycerol Stock
HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-2336s1c1
Sequence:CCGGGCTATGGAAGAGGTGCCTTTACTCGAGTAAAGGCACCTCTTCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172473.1-3307s1c1
Sequence:CCGGCGCATGTAAAGTACCATTTATCTCGAGATAAATGGTACTTTACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172473.1-2552s1c1
Sequence:CCGGCCGGAAATTGATGTAAATGATCTCGAGATCATTTACATCAATTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-749s1c1
Sequence:CCGGGCTGATATTAACAGGCCGAATCTCGAGATTCGGCCTGTTAATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-2495s1c1
Sequence:CCGGCCTTCCCTCATACAACTGTTTCTCGAGAAACAGTTGTATGAGGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-3386s21c1
Sequence:CCGGTTTCCCACGTTATACTTATATCTCGAGATATAAGTATAACGTGGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2898s21c1
Sequence:CCGGTGGTTATACAATGGCATAATGCTCGAGCATTATGCCATTGTATAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-1147s21c1
Sequence:CCGGTTGAGGATTGTGAGGATATTTCTCGAGAAATATCCTCACAATCCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2335s21c1
Sequence:CCGGGCTATGGAAGAGGTGCCTTTACTCGAGTAAAGGCACCTCTTCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2551s21c1
Sequence:CCGGCCGGAAATTGATGTAAATGATCTCGAGATCATTTACATCAATTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172473
VALIDATED
HACE1 MISSION shRNA shRNA Plasmid DNA
HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-2336s1c1
Sequence:CCGGGCTATGGAAGAGGTGCCTTTACTCGAGTAAAGGCACCTCTTCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172473.1-3307s1c1
Sequence:CCGGCGCATGTAAAGTACCATTTATCTCGAGATAAATGGTACTTTACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172473.1-2552s1c1
Sequence:CCGGCCGGAAATTGATGTAAATGATCTCGAGATCATTTACATCAATTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-749s1c1
Sequence:CCGGGCTGATATTAACAGGCCGAATCTCGAGATTCGGCCTGTTAATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-2495s1c1
Sequence:CCGGCCTTCCCTCATACAACTGTTTCTCGAGAAACAGTTGTATGAGGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-3386s21c1
Sequence:CCGGTTTCCCACGTTATACTTATATCTCGAGATATAAGTATAACGTGGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2898s21c1
Sequence:CCGGTGGTTATACAATGGCATAATGCTCGAGCATTATGCCATTGTATAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-1147s21c1
Sequence:CCGGTTGAGGATTGTGAGGATATTTCTCGAGAAATATCCTCACAATCCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2335s21c1
Sequence:CCGGGCTATGGAAGAGGTGCCTTTACTCGAGTAAAGGCACCTCTTCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2551s21c1
Sequence:CCGGCCGGAAATTGATGTAAATGATCTCGAGATCATTTACATCAATTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172473
VALIDATED
HACE1 MISSION shRNA Lentiviral Transduction Particles
HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-2336s1c1
Sequence:CCGGGCTATGGAAGAGGTGCCTTTACTCGAGTAAAGGCACCTCTTCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172473.1-3307s1c1
Sequence:CCGGCGCATGTAAAGTACCATTTATCTCGAGATAAATGGTACTTTACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172473.1-2552s1c1
Sequence:CCGGCCGGAAATTGATGTAAATGATCTCGAGATCATTTACATCAATTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-749s1c1
Sequence:CCGGGCTGATATTAACAGGCCGAATCTCGAGATTCGGCCTGTTAATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172473.1-2495s1c1
Sequence:CCGGCCTTCCCTCATACAACTGTTTCTCGAGAAACAGTTGTATGAGGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311551    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-3386s21c1
Sequence:CCGGTTTCCCACGTTATACTTATATCTCGAGATATAAGTATAACGTGGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2898s21c1
Sequence:CCGGTGGTTATACAATGGCATAATGCTCGAGCATTATGCCATTGTATAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-1147s21c1
Sequence:CCGGTTGAGGATTGTGAGGATATTTCTCGAGAAATATCCTCACAATCCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2335s21c1
Sequence:CCGGGCTATGGAAGAGGTGCCTTTACTCGAGTAAAGGCACCTCTTCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172473.2-2551s21c1
Sequence:CCGGCCGGAAATTGATGTAAATGATCTCGAGATCATTTACATCAATTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020771
HACE1 MISSION shRNA Bacterial Glycerol Stock
HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-2825s1c1
Sequence:CCGGGCTGTGCCATATACTCCAAATCTCGAGATTTGGAGTATATGGCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-2606s1c1
Sequence:CCGGCCAGAAATTGATGTGAGTGATCTCGAGATCACTCACATCAATTTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-1098s1c1
Sequence:CCGGGCCAGTACCTAAAGATTCTAACTCGAGTTAGAATCTTTAGGTACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-1556s1c1
Sequence:CCGGGCAGATTGTCAGGATGTTATTCTCGAGAATAACATCCTGACAATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020771.x-3994s1c1
Sequence:CCGGCGGAAGGATTTGTTATGTTTACTCGAGTAAACATAACAAATCCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-828s21c1
Sequence:CCGGTAGACAGTGGTGCTGATATTACTCGAGTAATATCAGCACCACTGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-1196s21c1
Sequence:CCGGCTTAGCCTCTCTAGCAATTATCTCGAGATAATTGCTAGAGAGGCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-1171s21c1
Sequence:CCGGTGCTACAACAAATGGTCATAACTCGAGTTATGACCATTTGTTGTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020771
HACE1 MISSION shRNA shRNA Plasmid DNA
HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-2825s1c1
Sequence:CCGGGCTGTGCCATATACTCCAAATCTCGAGATTTGGAGTATATGGCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-2606s1c1
Sequence:CCGGCCAGAAATTGATGTGAGTGATCTCGAGATCACTCACATCAATTTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-1098s1c1
Sequence:CCGGGCCAGTACCTAAAGATTCTAACTCGAGTTAGAATCTTTAGGTACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-1556s1c1
Sequence:CCGGGCAGATTGTCAGGATGTTATTCTCGAGAATAACATCCTGACAATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020771.x-3994s1c1
Sequence:CCGGCGGAAGGATTTGTTATGTTTACTCGAGTAAACATAACAAATCCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-828s21c1
Sequence:CCGGTAGACAGTGGTGCTGATATTACTCGAGTAATATCAGCACCACTGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-1196s21c1
Sequence:CCGGCTTAGCCTCTCTAGCAATTATCTCGAGATAATTGCTAGAGAGGCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-1171s21c1
Sequence:CCGGTGCTACAACAAATGGTCATAACTCGAGTTATGACCATTTGTTGTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020771
HACE1 MISSION shRNA Lentiviral Transduction Particles
HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-2825s1c1
Sequence:CCGGGCTGTGCCATATACTCCAAATCTCGAGATTTGGAGTATATGGCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-2606s1c1
Sequence:CCGGCCAGAAATTGATGTGAGTGATCTCGAGATCACTCACATCAATTTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-1098s1c1
Sequence:CCGGGCCAGTACCTAAAGATTCTAACTCGAGTTAGAATCTTTAGGTACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020771.x-1556s1c1
Sequence:CCGGGCAGATTGTCAGGATGTTATTCTCGAGAATAACATCCTGACAATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003414    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020771.x-3994s1c1
Sequence:CCGGCGGAAGGATTTGTTATGTTTACTCGAGTAAACATAACAAATCCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-828s21c1
Sequence:CCGGTAGACAGTGGTGCTGATATTACTCGAGTAATATCAGCACCACTGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-1196s21c1
Sequence:CCGGCTTAGCCTCTCTAGCAATTATCTCGAGATAATTGCTAGAGAGGCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020771.3-1171s21c1
Sequence:CCGGTGCTACAACAAATGGTCATAACTCGAGTTATGACCATTTGTTGTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)