EMAIL THIS PAGE TO A FRIEND

HACL1

2-hydroxyacyl-CoA lyase 1

57 Gene Product Result for
Synonyms: 2-HPCL HPCL HPCL2 PHYH2
UniProtKB ID: Q9UJ83, Q9BV42, Q9P0A2
Gene ID:
Mouse(56794) 2-hydroxyacyl-CoA lyase 1
Rat(85255) 2-hydroxyacyl-CoA lyase 1
sheep(101119009) 2-hydroxyacyl-CoA lyase 1
Domestic Rabbit(100342558) 2-hydroxyacyl-CoA lyase 1
domestic guinea pig(100731806) 2-hydroxyacyl-CoA lyase 1
naked mole-rat(101706829) 2-hydroxyacyl-CoA lyase 1
Zebrafish(406358) 2-hydroxyacyl-CoA lyase 1
chicken(420638) 2-hydroxyacyl-CoA lyase 1
cow(512676) 2-hydroxyacyl-CoA lyase 1
Horse(100063920) 2-hydroxyacyl-CoA lyase 1
domestic cat(101093708) 2-hydroxyacyl-CoA lyase 1
dog(477060) 2-hydroxyacyl-CoA lyase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012260 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012260 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012260 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012260 Rosetta Predictions human pricing
NM_053493 Rosetta Predictions rat pricing
NM_019975 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012260 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192548 predicted 525
2 SASI_Hs02_00343981 predicted 1228
3 SASI_Hs01_00192549 predicted 817
4 SASI_Hs01_00192551 predicted 1803
5 SASI_Hs01_00192552 predicted 623
6 SASI_Hs01_00192553 predicted 235
7 SASI_Hs01_00192554 predicted 1332
8 SASI_Hs01_00192555 predicted 1554
9 SASI_Hs02_00343982 predicted 822
10 SASI_Hs01_00192557 predicted 1312
11 SASI_Hs01_00192550 predicted 1284
12 SASI_Hs01_00192556 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034815 predicted 1387
2 SASI_Rn01_00034816 predicted 921
3 SASI_Rn01_00034817 predicted 257
4 SASI_Rn01_00034818 predicted 1499
5 SASI_Rn01_00034819 predicted 1670
6 SASI_Rn01_00034820 predicted 335
7 SASI_Rn01_00034821 predicted 944
8 SASI_Rn01_00034822 predicted 996
9 SASI_Rn01_00034824 predicted 1225
10 SASI_Rn02_00266099 predicted 1753
11 SASI_Rn01_00034823 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137439 predicted 1520
2 SASI_Mm01_00137440 predicted 511
3 SASI_Mm01_00137442 predicted 1495
4 SASI_Mm01_00137443 predicted 1656
5 SASI_Mm01_00137444 predicted 929
6 SASI_Mm02_00325280 predicted 1653
7 SASI_Mm02_00325281 predicted 1495
8 SASI_Mm01_00137447 predicted 471
9 SASI_Mm02_00325282 predicted 409
10 SASI_Mm02_00325283 predicted 516
11 SASI_Mm01_00137441 predicted 1616
12 SASI_Mm01_00137445 predicted 1739
13 SASI_Mm01_00137446 predicted 990
14 SASI_Mm01_00137448 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019975
HACL1 MISSION shRNA Bacterial Glycerol Stock
2-hydroxyacyl-CoA lyase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019975.2-1866s1c1
Sequence:CCGGCCCGCAAGGTAGAATTTACTTCTCGAGAAGTAAATTCTACCTTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-933s1c1
Sequence:CCGGGCGAGACTAAACTGGATCTTACTCGAGTAAGATCCAGTTTAGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-1512s1c1
Sequence:CCGGCCAATCATACTCTTGGTAGTACTCGAGTACTACCAAGAGTATGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-909s1c1
Sequence:CCGGGCTGACGTGATTGTGTTATTTCTCGAGAAATAACACAATCACGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-908s1c1
Sequence:CCGGCGCTGACGTGATTGTGTTATTCTCGAGAATAACACAATCACGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019975
HACL1 MISSION shRNA shRNA Plasmid DNA
2-hydroxyacyl-CoA lyase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019975.2-1866s1c1
Sequence:CCGGCCCGCAAGGTAGAATTTACTTCTCGAGAAGTAAATTCTACCTTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-933s1c1
Sequence:CCGGGCGAGACTAAACTGGATCTTACTCGAGTAAGATCCAGTTTAGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-1512s1c1
Sequence:CCGGCCAATCATACTCTTGGTAGTACTCGAGTACTACCAAGAGTATGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-909s1c1
Sequence:CCGGGCTGACGTGATTGTGTTATTTCTCGAGAAATAACACAATCACGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-908s1c1
Sequence:CCGGCGCTGACGTGATTGTGTTATTCTCGAGAATAACACAATCACGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019975
HACL1 MISSION shRNA Lentiviral Transduction Particles
2-hydroxyacyl-CoA lyase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019975.2-1866s1c1
Sequence:CCGGCCCGCAAGGTAGAATTTACTTCTCGAGAAGTAAATTCTACCTTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-933s1c1
Sequence:CCGGGCGAGACTAAACTGGATCTTACTCGAGTAAGATCCAGTTTAGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-1512s1c1
Sequence:CCGGCCAATCATACTCTTGGTAGTACTCGAGTACTACCAAGAGTATGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-909s1c1
Sequence:CCGGGCTGACGTGATTGTGTTATTTCTCGAGAAATAACACAATCACGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019975.2-908s1c1
Sequence:CCGGCGCTGACGTGATTGTGTTATTCTCGAGAATAACACAATCACGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012260
HACL1 MISSION shRNA Bacterial Glycerol Stock
2-hydroxyacyl-CoA lyase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-1049s1c1
Sequence:CCGGCCGCTGTTACTTTGCTAGGAACTCGAGTTCCTAGCAAAGTAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-973s1c1
Sequence:CCGGCCTCCAAGATATCAGCCAGATCTCGAGATCTGGCTGATATCTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-524s1c1
Sequence:CCGGGCAGCATAGAAGCTATTCCTTCTCGAGAAGGAATAGCTTCTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-1545s1c1
Sequence:CCGGCAATGGAATTTACCAAGGTTTCTCGAGAAACCTTGGTAAATTCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-715s1c1
Sequence:CCGGGCGGCTTCTGTTATTAGGAATCTCGAGATTCCTAATAACAGAAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012260
HACL1 MISSION shRNA shRNA Plasmid DNA
2-hydroxyacyl-CoA lyase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-1049s1c1
Sequence:CCGGCCGCTGTTACTTTGCTAGGAACTCGAGTTCCTAGCAAAGTAACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-973s1c1
Sequence:CCGGCCTCCAAGATATCAGCCAGATCTCGAGATCTGGCTGATATCTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-524s1c1
Sequence:CCGGGCAGCATAGAAGCTATTCCTTCTCGAGAAGGAATAGCTTCTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-1545s1c1
Sequence:CCGGCAATGGAATTTACCAAGGTTTCTCGAGAAACCTTGGTAAATTCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-715s1c1
Sequence:CCGGGCGGCTTCTGTTATTAGGAATCTCGAGATTCCTAATAACAGAAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012260
HACL1 MISSION shRNA Lentiviral Transduction Particles
2-hydroxyacyl-CoA lyase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-1049s1c1
Sequence:CCGGCCGCTGTTACTTTGCTAGGAACTCGAGTTCCTAGCAAAGTAACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-973s1c1
Sequence:CCGGCCTCCAAGATATCAGCCAGATCTCGAGATCTGGCTGATATCTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-524s1c1
Sequence:CCGGGCAGCATAGAAGCTATTCCTTCTCGAGAAGGAATAGCTTCTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-1545s1c1
Sequence:CCGGCAATGGAATTTACCAAGGTTTCTCGAGAAACCTTGGTAAATTCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012260.1-715s1c1
Sequence:CCGGGCGGCTTCTGTTATTAGGAATCTCGAGATTCCTAATAACAGAAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)