EMAIL THIS PAGE TO A FRIEND

HADH

hydroxyacyl-CoA dehydrogenase

49 Gene Product Result for
Synonyms: HAD HADH1 HADHSC HCDH HHF4 MSCHAD SCHAD
UniProtKB ID: Q16836, J3KQ17, O00324, O00397, O00753, Q4W5B4
Gene ID:
Human(3033) Summary: This gene is a member of the 3-hydroxyacyl-CoA dehydrogenase gene family. The encoded protein functions in the mitochondrial matrix to catalyze the oxidation of straight-chain 3-hydroxyacyl-CoAs as part of the beta-oxidation pathway. Its enzymatic activity is highest with medium-chain-length fatty acids. Mutations in this gene cause one form of familial hyperinsulinemic hypoglycemia. The human genome contains a related pseudogene of this gene on chromosome 15. [provided by RefSeq, May 2010]
Mouse(15107) hydroxyacyl-Coenzyme A dehydrogenase
Rat(113965) hydroxyacyl-CoA dehydrogenase
Zebrafish(445121) hydroxyacyl-Coenzyme A dehydrogenase
dog(478506) hydroxyacyl-CoA dehydrogenase
domestic cat(101088327) hydroxyacyl-CoA dehydrogenase
cow(532785) hydroxyacyl-CoA dehydrogenase
chicken(420290) hydroxyacyl-CoA dehydrogenase
sheep(101122862) hydroxyacyl-CoA dehydrogenase
domestic guinea pig(100715786) hydroxyacyl-CoA dehydrogenase
naked mole-rat(101712136) hydroxyacyl-CoA dehydrogenase
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005327 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005327 Rosetta Predictions human pricing
NM_057186 Rosetta Predictions rat pricing
NM_008212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145883 predicted 868
2 SASI_Hs01_00145885 predicted 209
3 SASI_Hs01_00145886 predicted 719
4 SASI_Hs01_00145887 predicted 1177
5 SASI_Hs02_00339391 predicted 350
6 SASI_Hs01_00145888 predicted 921
7 SASI_Hs01_00145889 predicted 1037
8 SASI_Hs01_00145890 predicted 915
9 SASI_Hs01_00145891 predicted 396
10 SASI_Hs01_00145892 predicted 946
11 SASI_Hs01_00145884 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057186 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087316 predicted 684
2 SASI_Rn01_00087317 predicted 227
3 SASI_Rn01_00087318 predicted 516
4 SASI_Rn01_00087319 predicted 259
5 SASI_Rn01_00087320 predicted 838
6 SASI_Rn01_00087321 predicted 817
7 SASI_Rn01_00087322 predicted 1089
8 SASI_Rn01_00087323 predicted 224
9 SASI_Rn01_00087324 predicted 666
10 SASI_Rn01_00087325 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161222 predicted 792
2 SASI_Mm01_00161223 predicted 241
3 SASI_Mm01_00161225 predicted 229
4 SASI_Mm02_00313379 predicted 819
5 SASI_Mm01_00161226 predicted 515
6 SASI_Mm02_00313380 predicted 254
7 SASI_Mm01_00161228 predicted 314
8 SASI_Mm01_00161229 predicted 914
9 SASI_Mm01_00161230 predicted 691
10 SASI_Mm01_00161231 predicted 848
11 SASI_Mm01_00161224 predicted 1447
12 SASI_Mm01_00161227 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008212
VALIDATED
HADH MISSION shRNA Bacterial Glycerol Stock
hydroxyacyl-CoA dehydrogenase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-463s1c1
Sequence:CCGGCGTCTTCTTTGCAGATCACAACTCGAGTTGTGATCTGCAAAGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-252s1c1
Sequence:CCGGGCAAAGAAGAAGTTCACAGAACTCGAGTTCTGTGAACTTCTTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008212.1-1065s1c1
Sequence:CCGGCCTTGCAGTCTCTCTGAAGTACTCGAGTACTTCAGAGAGACTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-884s1c1
Sequence:CCGGGCCCAGTCCTTCCATGAATAACTCGAGTTATTCATGGAAGGACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-792s1c1
Sequence:CCGGCCGTTTGAGCTTCTTGACTATCTCGAGATAGTCAAGAAGCTCAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008212
VALIDATED
HADH MISSION shRNA shRNA Plasmid DNA
hydroxyacyl-CoA dehydrogenase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-463s1c1
Sequence:CCGGCGTCTTCTTTGCAGATCACAACTCGAGTTGTGATCTGCAAAGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-252s1c1
Sequence:CCGGGCAAAGAAGAAGTTCACAGAACTCGAGTTCTGTGAACTTCTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008212.1-1065s1c1
Sequence:CCGGCCTTGCAGTCTCTCTGAAGTACTCGAGTACTTCAGAGAGACTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-884s1c1
Sequence:CCGGGCCCAGTCCTTCCATGAATAACTCGAGTTATTCATGGAAGGACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-792s1c1
Sequence:CCGGCCGTTTGAGCTTCTTGACTATCTCGAGATAGTCAAGAAGCTCAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008212
VALIDATED
HADH MISSION shRNA Lentiviral Transduction Particles
hydroxyacyl-CoA dehydrogenase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-463s1c1
Sequence:CCGGCGTCTTCTTTGCAGATCACAACTCGAGTTGTGATCTGCAAAGAAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-252s1c1
Sequence:CCGGGCAAAGAAGAAGTTCACAGAACTCGAGTTCTGTGAACTTCTTCTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041513    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008212.1-1065s1c1
Sequence:CCGGCCTTGCAGTCTCTCTGAAGTACTCGAGTACTTCAGAGAGACTGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-884s1c1
Sequence:CCGGGCCCAGTCCTTCCATGAATAACTCGAGTTATTCATGGAAGGACTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008212.1-792s1c1
Sequence:CCGGCCGTTTGAGCTTCTTGACTATCTCGAGATAGTCAAGAAGCTCAAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005327
VALIDATED
HADH MISSION shRNA Bacterial Glycerol Stock
hydroxyacyl-CoA dehydrogenase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-413s21c1
Sequence:CCGGCGGCGATGAATTTGTGGAGAACTCGAGTTCTCCACAAATTCATCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-448s1c1
Sequence:CCGGGTGGAGAATCTGAAGGTGAAACTCGAGTTTCACCTTCAGATTCTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-944s21c1
Sequence:CCGGCGGACTGGATACTACGAAGTTCTCGAGAACTTCGTAGTATCCAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-351s1c1
Sequence:CCGGCGGCGATGAATTTGTGGAGAACTCGAGTTCTCCACAAATTCATCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005327.1-951s1c1
Sequence:CCGGGCCCAGCCCATCCTTAAATAACTCGAGTTATTTAAGGATGGGCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005327.1-882s1c1
Sequence:CCGGCGGACTGGATACTACGAAGTTCTCGAGAACTTCGTAGTATCCAGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-499s1c1
Sequence:CCGGGCTGCTGAACATACAATCTTTCTCGAGAAAGATTGTATGTTCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-561s21c1
Sequence:CCGGGCTGCTGAACATACAATCTTTCTCGAGAAAGATTGTATGTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-1013s21c1
Sequence:CCGGGCCCAGCCCATCCTTAAATAACTCGAGTTATTTAAGGATGGGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005327
VALIDATED
HADH MISSION shRNA shRNA Plasmid DNA
hydroxyacyl-CoA dehydrogenase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-413s21c1
Sequence:CCGGCGGCGATGAATTTGTGGAGAACTCGAGTTCTCCACAAATTCATCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-448s1c1
Sequence:CCGGGTGGAGAATCTGAAGGTGAAACTCGAGTTTCACCTTCAGATTCTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-944s21c1
Sequence:CCGGCGGACTGGATACTACGAAGTTCTCGAGAACTTCGTAGTATCCAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-351s1c1
Sequence:CCGGCGGCGATGAATTTGTGGAGAACTCGAGTTCTCCACAAATTCATCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005327.1-951s1c1
Sequence:CCGGGCCCAGCCCATCCTTAAATAACTCGAGTTATTTAAGGATGGGCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005327.1-882s1c1
Sequence:CCGGCGGACTGGATACTACGAAGTTCTCGAGAACTTCGTAGTATCCAGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-499s1c1
Sequence:CCGGGCTGCTGAACATACAATCTTTCTCGAGAAAGATTGTATGTTCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-561s21c1
Sequence:CCGGGCTGCTGAACATACAATCTTTCTCGAGAAAGATTGTATGTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-1013s21c1
Sequence:CCGGGCCCAGCCCATCCTTAAATAACTCGAGTTATTTAAGGATGGGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005327
VALIDATED
HADH MISSION shRNA Lentiviral Transduction Particles
hydroxyacyl-CoA dehydrogenase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-413s21c1
Sequence:CCGGCGGCGATGAATTTGTGGAGAACTCGAGTTCTCCACAAATTCATCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-448s1c1
Sequence:CCGGGTGGAGAATCTGAAGGTGAAACTCGAGTTTCACCTTCAGATTCTCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-944s21c1
Sequence:CCGGCGGACTGGATACTACGAAGTTCTCGAGAACTTCGTAGTATCCAGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-351s1c1
Sequence:CCGGCGGCGATGAATTTGTGGAGAACTCGAGTTCTCCACAAATTCATCGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005327.1-951s1c1
Sequence:CCGGGCCCAGCCCATCCTTAAATAACTCGAGTTATTTAAGGATGGGCTGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_005327.1-882s1c1
Sequence:CCGGCGGACTGGATACTACGAAGTTCTCGAGAACTTCGTAGTATCCAGTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005327.1-499s1c1
Sequence:CCGGGCTGCTGAACATACAATCTTTCTCGAGAAAGATTGTATGTTCAGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-561s21c1
Sequence:CCGGGCTGCTGAACATACAATCTTTCTCGAGAAAGATTGTATGTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005327.2-1013s21c1
Sequence:CCGGGCCCAGCCCATCCTTAAATAACTCGAGTTATTTAAGGATGGGCTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)