EMAIL THIS PAGE TO A FRIEND

HADHA

hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit

68 Gene Product Result for
Synonyms: ECHA GBP HADH LCEH LCHAD MTPA TP-ALPHA
UniProtKB ID: P40939, B2R7L4, Q16679, Q53T69, Q53TA2, Q96GT7
Gene ID:
Human(3030) Summary: This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]
Mouse(97212) hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit
Rat(170670) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
domestic guinea pig(100723555) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
naked mole-rat(101724137) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
sheep(100192316) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Domestic Rabbit(100355022) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
chicken(395929) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
cow(281810) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Horse(100071381) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
domestic cat(101084701) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
dog(475687) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Gene Class: Dehydratase, Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000182 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000182 Rosetta Predictions human pricing
NM_130826 Rosetta Predictions rat pricing
XM_579615 Rosetta Predictions rat pricing
NM_178878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131998 predicted 1470
2 SASI_Hs01_00131999 predicted 1100
3 SASI_Hs02_00302023 predicted 840
4 SASI_Hs02_00302024 predicted 243
5 SASI_Hs02_00302025 predicted 285
6 SASI_Hs01_00132001 predicted 2490
7 SASI_Hs01_00132002 predicted 1205
8 SASI_Hs01_00132003 predicted 902
9 SASI_Hs01_00132005 predicted 2015
10 SASI_Hs01_00132006 predicted 1329
11 SASI_Hs01_00132000 predicted 221
12 SASI_Hs01_00132004 predicted 984
13 SASI_Hs01_00132007 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087517 predicted 1485
2 SASI_Rn02_00267522 predicted 2124
3 SASI_Rn01_00087518 predicted 932
4 SASI_Rn01_00087519 predicted 727
5 SASI_Rn02_00267523 predicted 709
6 SASI_Rn01_00087520 predicted 714
7 SASI_Rn01_00087521 predicted 1840
8 SASI_Rn01_00087522 predicted 2214
9 SASI_Rn01_00087523 predicted 1086
10 SASI_Rn01_00087524 predicted 2180
11 SASI_Rn01_00087516 predicted 2379
12 SASI_Rn01_00087525 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579615 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186737 predicted 797
2 SASI_Rn01_00186738 predicted 856
3 SASI_Rn01_00186739 predicted 687
4 SASI_Rn01_00186740 predicted 1161
5 SASI_Rn01_00186741 predicted 549
6 SASI_Rn01_00186742 predicted 1526
7 SASI_Rn01_00186743 predicted 404
8 SASI_Rn01_00186744 predicted 1490
9 SASI_Rn01_00186745 predicted 628
10 SASI_Rn01_00186746 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349462 predicted 233
2 SASI_Mm01_00167620 predicted 1496
3 SASI_Mm01_00167622 predicted 342
4 SASI_Mm01_00167624 predicted 1273
5 SASI_Mm01_00167625 predicted 951
6 SASI_Mm02_00349463 predicted 2291
7 SASI_Mm01_00167626 predicted 2193
8 SASI_Mm01_00167627 predicted 1966
9 SASI_Mm01_00167628 predicted 1552
10 SASI_Mm01_00167629 predicted 1367
11 SASI_Mm01_00167621 predicted 2142
12 SASI_Mm01_00167623 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178878
VALIDATED
HADHA MISSION shRNA Bacterial Glycerol Stock
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-137s21c1
Sequence:CCGGGCTGACCAGAACCCATATTAACTCGAGTTAATATGGGTTCTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178878.2-2035s21c1
Sequence:CCGGCCTCTGATGAAGACGTCCAATCTCGAGATTGGACGTCTTCATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-499s21c1
Sequence:CCGGGCCAATACAGAATAGCAACAACTCGAGTTGTTGCTATTCTGTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-378s21c1
Sequence:CCGGGCAACACGAATATCACAGGAACTCGAGTTCCTGTGATATTCGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178878.2-1464s21c1
Sequence:CCGGGCTCTCCCAATCAATCAAATTCTCGAGAATTTGATTGATTGGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-138s1c1
Sequence:CCGGGCTGACCAGAACCCATATTAACTCGAGTTAATATGGGTTCTGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-379s1c1
Sequence:CCGGGCAACACGAATATCACAGGAACTCGAGTTCCTGTGATATTCGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-1465s1c1
Sequence:CCGGGCTCTCCCAATCAATCAAATTCTCGAGAATTTGATTGATTGGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-500s1c1
Sequence:CCGGGCCAATACAGAATAGCAACAACTCGAGTTGTTGCTATTCTGTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-2036s1c1
Sequence:CCGGCCTCTGATGAAGACGTCCAATCTCGAGATTGGACGTCTTCATCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178878
VALIDATED
HADHA MISSION shRNA shRNA Plasmid DNA
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-137s21c1
Sequence:CCGGGCTGACCAGAACCCATATTAACTCGAGTTAATATGGGTTCTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178878.2-2035s21c1
Sequence:CCGGCCTCTGATGAAGACGTCCAATCTCGAGATTGGACGTCTTCATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-499s21c1
Sequence:CCGGGCCAATACAGAATAGCAACAACTCGAGTTGTTGCTATTCTGTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-378s21c1
Sequence:CCGGGCAACACGAATATCACAGGAACTCGAGTTCCTGTGATATTCGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178878.2-1464s21c1
Sequence:CCGGGCTCTCCCAATCAATCAAATTCTCGAGAATTTGATTGATTGGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-138s1c1
Sequence:CCGGGCTGACCAGAACCCATATTAACTCGAGTTAATATGGGTTCTGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-379s1c1
Sequence:CCGGGCAACACGAATATCACAGGAACTCGAGTTCCTGTGATATTCGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-1465s1c1
Sequence:CCGGGCTCTCCCAATCAATCAAATTCTCGAGAATTTGATTGATTGGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-500s1c1
Sequence:CCGGGCCAATACAGAATAGCAACAACTCGAGTTGTTGCTATTCTGTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-2036s1c1
Sequence:CCGGCCTCTGATGAAGACGTCCAATCTCGAGATTGGACGTCTTCATCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178878
VALIDATED
HADHA MISSION shRNA Lentiviral Transduction Particles
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-137s21c1
Sequence:CCGGGCTGACCAGAACCCATATTAACTCGAGTTAATATGGGTTCTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178878.2-2035s21c1
Sequence:CCGGCCTCTGATGAAGACGTCCAATCTCGAGATTGGACGTCTTCATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-499s21c1
Sequence:CCGGGCCAATACAGAATAGCAACAACTCGAGTTGTTGCTATTCTGTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178878.2-378s21c1
Sequence:CCGGGCAACACGAATATCACAGGAACTCGAGTTCCTGTGATATTCGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178878.2-1464s21c1
Sequence:CCGGGCTCTCCCAATCAATCAAATTCTCGAGAATTTGATTGATTGGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-138s1c1
Sequence:CCGGGCTGACCAGAACCCATATTAACTCGAGTTAATATGGGTTCTGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-379s1c1
Sequence:CCGGGCAACACGAATATCACAGGAACTCGAGTTCCTGTGATATTCGTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-1465s1c1
Sequence:CCGGGCTCTCCCAATCAATCAAATTCTCGAGAATTTGATTGATTGGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-500s1c1
Sequence:CCGGGCCAATACAGAATAGCAACAACTCGAGTTGTTGCTATTCTGTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178878.1-2036s1c1
Sequence:CCGGCCTCTGATGAAGACGTCCAATCTCGAGATTGGACGTCTTCATCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000182
VALIDATED
HADHA MISSION shRNA Bacterial Glycerol Stock
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-2590s21c1
Sequence:CCGGGTGAAGTGTGACTTCGAATTACTCGAGTAATTCGAAGTCACACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000182.4-2004s21c1
Sequence:CCGGAGGGCTTCCTAGGTCGTAAATCTCGAGATTTACGACCTAGGAAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-274s21c1
Sequence:CCGGTGTGGCAGTTGTTCGAATTAACTCGAGTTAATTCGAACAACTGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-234s21c1
Sequence:CCGGTGCTGACCAGAACCCATATTACTCGAGTAATATGGGTTCTGGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-185s21c1
Sequence:CCGGCTCCGCTCCCGAGGTTATATACTCGAGTATATAACCTCGGGAGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000182.4-2158s21c1
Sequence:CCGGCCTGGTGACAAGATTTGTGAACTCGAGTTCACAAATCTTGTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-1066s1c1
Sequence:CCGGCCTGTGCAAGAAGAATAAATTCTCGAGAATTTATTCTTCTTGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-89s1c1
Sequence:CCGGCGAGGTTATATATGCCGCAATCTCGAGATTGCGGCATATATAACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-2053s1c1
Sequence:CCGGCCTGGTGACAAGATTTGTGAACTCGAGTTCACAAATCTTGTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000182.3-142s1c1
Sequence:CCGGCCATATTAACTATGGAGTCAACTCGAGTTGACTCCATAGTTAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000182.3-2281s1c1
Sequence:CCGGCCATGCTAACAGCCCTAACAACTCGAGTTGTTAGGGCTGTTAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000182
VALIDATED
HADHA MISSION shRNA shRNA Plasmid DNA
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-2590s21c1
Sequence:CCGGGTGAAGTGTGACTTCGAATTACTCGAGTAATTCGAAGTCACACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000182.4-2004s21c1
Sequence:CCGGAGGGCTTCCTAGGTCGTAAATCTCGAGATTTACGACCTAGGAAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-274s21c1
Sequence:CCGGTGTGGCAGTTGTTCGAATTAACTCGAGTTAATTCGAACAACTGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-234s21c1
Sequence:CCGGTGCTGACCAGAACCCATATTACTCGAGTAATATGGGTTCTGGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-185s21c1
Sequence:CCGGCTCCGCTCCCGAGGTTATATACTCGAGTATATAACCTCGGGAGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000182.4-2158s21c1
Sequence:CCGGCCTGGTGACAAGATTTGTGAACTCGAGTTCACAAATCTTGTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-1066s1c1
Sequence:CCGGCCTGTGCAAGAAGAATAAATTCTCGAGAATTTATTCTTCTTGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-89s1c1
Sequence:CCGGCGAGGTTATATATGCCGCAATCTCGAGATTGCGGCATATATAACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-2053s1c1
Sequence:CCGGCCTGGTGACAAGATTTGTGAACTCGAGTTCACAAATCTTGTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000182.3-142s1c1
Sequence:CCGGCCATATTAACTATGGAGTCAACTCGAGTTGACTCCATAGTTAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000182.3-2281s1c1
Sequence:CCGGCCATGCTAACAGCCCTAACAACTCGAGTTGTTAGGGCTGTTAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000182
VALIDATED
HADHA MISSION shRNA Lentiviral Transduction Particles
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245292    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-2590s21c1
Sequence:CCGGGTGAAGTGTGACTTCGAATTACTCGAGTAATTCGAAGTCACACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000182.4-2004s21c1
Sequence:CCGGAGGGCTTCCTAGGTCGTAAATCTCGAGATTTACGACCTAGGAAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-274s21c1
Sequence:CCGGTGTGGCAGTTGTTCGAATTAACTCGAGTTAATTCGAACAACTGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-234s21c1
Sequence:CCGGTGCTGACCAGAACCCATATTACTCGAGTAATATGGGTTCTGGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000182.4-185s21c1
Sequence:CCGGCTCCGCTCCCGAGGTTATATACTCGAGTATATAACCTCGGGAGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000182.4-2158s21c1
Sequence:CCGGCCTGGTGACAAGATTTGTGAACTCGAGTTCACAAATCTTGTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-1066s1c1
Sequence:CCGGCCTGTGCAAGAAGAATAAATTCTCGAGAATTTATTCTTCTTGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-89s1c1
Sequence:CCGGCGAGGTTATATATGCCGCAATCTCGAGATTGCGGCATATATAACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000182.3-2053s1c1
Sequence:CCGGCCTGGTGACAAGATTTGTGAACTCGAGTTCACAAATCTTGTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000182.3-142s1c1
Sequence:CCGGCCATATTAACTATGGAGTCAACTCGAGTTGACTCCATAGTTAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000182.3-2281s1c1
Sequence:CCGGCCATGCTAACAGCCCTAACAACTCGAGTTGTTAGGGCTGTTAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)