EMAIL THIS PAGE TO A FRIEND

HADHB

hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit

93 Gene Product Result for
Synonyms: ECHB MTPB TP-BETA
Gene ID:
Human(3032) Summary: This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. Mutations in this gene result in trifunctional protein deficiency. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Alternatively spliced transcript variants have been found; however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(231086) hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit
Rat(171155) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Zebrafish(336606) hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit
chicken(421995) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
domestic cat(101084279) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
cow(281811) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Horse(100071371) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
dog(607926) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
sheep(101109685) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
domestic guinea pig(100725220) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
naked mole-rat(101725212) hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Gene Class: Dehydratase, Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000183 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157491 MISSION® esiRNA esiRNA human HADHB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000183 siRNAs that have been validated in the lab human pricing
NM_133618 Rosetta Predictions rat pricing
NM_145558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000183 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112914 validated 1271
1 SASI_Hs01_00112915 validated 1441
1 SASI_Hs01_00112916 validated 738
2 SASI_Hs02_00302026 predicted 843
3 SASI_Hs01_00112917 predicted 763
4 SASI_Hs01_00112918 predicted 803
5 SASI_Hs01_00112920 predicted 584
6 SASI_Hs02_00302027 predicted 1312
7 SASI_Hs01_00112921 predicted 1388
8 SASI_Hs02_00302028 predicted 1310
9 SASI_Hs02_00302029 predicted 390
10 SASI_Hs01_00112919 predicted 1509
11 SASI_Hs01_00112922 predicted 975
12 SASI_Hs01_00112923 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061733 predicted 269
2 SASI_Rn01_00061734 predicted 612
3 SASI_Rn01_00061735 predicted 1118
4 SASI_Rn01_00061736 predicted 885
5 SASI_Rn01_00061737 predicted 793
6 SASI_Rn01_00061738 predicted 937
7 SASI_Rn01_00061739 predicted 358
8 SASI_Rn01_00061740 predicted 521
9 SASI_Rn01_00061742 predicted 289
10 SASI_Rn02_00267843 predicted 474
11 SASI_Rn01_00061741 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043731 predicted 615
2 SASI_Mm01_00043732 predicted 1006
3 SASI_Mm01_00043734 predicted 1423
4 SASI_Mm01_00043735 predicted 742
5 SASI_Mm01_00043736 predicted 525
6 SASI_Mm01_00043737 predicted 355
7 SASI_Mm01_00043738 predicted 811
8 SASI_Mm01_00043739 predicted 290
9 SASI_Mm02_00341055 predicted 517
10 SASI_Mm01_00043740 predicted 472
11 SASI_Mm01_00043733 predicted 838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145558
VALIDATED
HADHB MISSION shRNA Bacterial Glycerol Stock
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-909s1c1
Sequence:CCGGCCTGCGTTCATCAAACCCTATCTCGAGATAGGGTTTGATGAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145558.1-809s21c1
Sequence:CCGGCCTTTCTGATATTGTACCCTTCTCGAGAAGGGTACAATATCAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-434s1c1
Sequence:CCGGCATGGCTTGTATCTCTTCAAACTCGAGTTTGAAGAGATACAAGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-1125s1c1
Sequence:CCGGGCAGGGTTAACCATGAATGATCTCGAGATCATTCATGGTTAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-543s1c1
Sequence:CCGGCCTATTCGTCATTCAAGAAATCTCGAGATTTCTTGAATGACGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145558.1-809s1c1
Sequence:CCGGCCTTTCTGATATTGTACCCTTCTCGAGAAGGGTACAATATCAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-543s21c1
Sequence:CCGGCCTATTCGTCATTCAAGAAATCTCGAGATTTCTTGAATGACGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-434s21c1
Sequence:CCGGCATGGCTTGTATCTCTTCAAACTCGAGTTTGAAGAGATACAAGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-909s21c1
Sequence:CCGGCCTGCGTTCATCAAACCCTATCTCGAGATAGGGTTTGATGAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145558.1-1125s21c1
Sequence:CCGGGCAGGGTTAACCATGAATGATCTCGAGATCATTCATGGTTAACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145558
VALIDATED
HADHB MISSION shRNA shRNA Plasmid DNA
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-909s1c1
Sequence:CCGGCCTGCGTTCATCAAACCCTATCTCGAGATAGGGTTTGATGAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145558.1-809s21c1
Sequence:CCGGCCTTTCTGATATTGTACCCTTCTCGAGAAGGGTACAATATCAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-434s1c1
Sequence:CCGGCATGGCTTGTATCTCTTCAAACTCGAGTTTGAAGAGATACAAGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-1125s1c1
Sequence:CCGGGCAGGGTTAACCATGAATGATCTCGAGATCATTCATGGTTAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-543s1c1
Sequence:CCGGCCTATTCGTCATTCAAGAAATCTCGAGATTTCTTGAATGACGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145558.1-809s1c1
Sequence:CCGGCCTTTCTGATATTGTACCCTTCTCGAGAAGGGTACAATATCAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-543s21c1
Sequence:CCGGCCTATTCGTCATTCAAGAAATCTCGAGATTTCTTGAATGACGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-434s21c1
Sequence:CCGGCATGGCTTGTATCTCTTCAAACTCGAGTTTGAAGAGATACAAGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-909s21c1
Sequence:CCGGCCTGCGTTCATCAAACCCTATCTCGAGATAGGGTTTGATGAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145558.1-1125s21c1
Sequence:CCGGGCAGGGTTAACCATGAATGATCTCGAGATCATTCATGGTTAACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145558
VALIDATED
HADHB MISSION shRNA Lentiviral Transduction Particles
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-909s1c1
Sequence:CCGGCCTGCGTTCATCAAACCCTATCTCGAGATAGGGTTTGATGAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145558.1-809s21c1
Sequence:CCGGCCTTTCTGATATTGTACCCTTCTCGAGAAGGGTACAATATCAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-434s1c1
Sequence:CCGGCATGGCTTGTATCTCTTCAAACTCGAGTTTGAAGAGATACAAGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-1125s1c1
Sequence:CCGGGCAGGGTTAACCATGAATGATCTCGAGATCATTCATGGTTAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145558.1-543s1c1
Sequence:CCGGCCTATTCGTCATTCAAGAAATCTCGAGATTTCTTGAATGACGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145558.1-809s1c1
Sequence:CCGGCCTTTCTGATATTGTACCCTTCTCGAGAAGGGTACAATATCAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-543s21c1
Sequence:CCGGCCTATTCGTCATTCAAGAAATCTCGAGATTTCTTGAATGACGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-434s21c1
Sequence:CCGGCATGGCTTGTATCTCTTCAAACTCGAGTTTGAAGAGATACAAGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145558.1-909s21c1
Sequence:CCGGCCTGCGTTCATCAAACCCTATCTCGAGATAGGGTTTGATGAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145558.1-1125s21c1
Sequence:CCGGGCAGGGTTAACCATGAATGATCTCGAGATCATTCATGGTTAACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000183
VALIDATED
HADHB MISSION shRNA Bacterial Glycerol Stock
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-326s1c1
Sequence:CCGGCCTAAGGAAGTAGTTGATTATCTCGAGATAATCAACTACTTCCTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-629s1c1
Sequence:CCGGCGACTGTCTTTAATCTCTAAACTCGAGTTTAGAGATTAAAGACAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-1370s1c1
Sequence:CCGGGCCAACAGATTACGGAAAGAACTCGAGTTCTTTCCGTAATCTGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-180s1c1
Sequence:CCGGCGTTAGCCAAACCCAATATAACTCGAGTTATATTGGGTTTGGCTAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-758s1c1
Sequence:CCGGCGGCTGGAACAGGATGAATATCTCGAGATATTCATCCTGTTCCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-1242s21c1
Sequence:CCGGTATAAGCCGAAGGCATATTTGCTCGAGCAAATATGCCTTCGGCTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-385s21c1
Sequence:CCGGCGTTAGCCAAACCCAATATAACTCGAGTTATATTGGGTTTGGCTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000183.2-834s21c1
Sequence:CCGGCGACTGTCTTTAATCTCTAAACTCGAGTTTAGAGATTAAAGACAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-1932s21c1
Sequence:CCGGGTTGTCACTAAAGACTAAATGCTCGAGCATTTAGTCTTTAGTGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000183.2-530s21c1
Sequence:CCGGCCCTAAGGAAGTAGTTGATTACTCGAGTAATCAACTACTTCCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000183
VALIDATED
HADHB MISSION shRNA shRNA Plasmid DNA
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-326s1c1
Sequence:CCGGCCTAAGGAAGTAGTTGATTATCTCGAGATAATCAACTACTTCCTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-629s1c1
Sequence:CCGGCGACTGTCTTTAATCTCTAAACTCGAGTTTAGAGATTAAAGACAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-1370s1c1
Sequence:CCGGGCCAACAGATTACGGAAAGAACTCGAGTTCTTTCCGTAATCTGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-180s1c1
Sequence:CCGGCGTTAGCCAAACCCAATATAACTCGAGTTATATTGGGTTTGGCTAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-758s1c1
Sequence:CCGGCGGCTGGAACAGGATGAATATCTCGAGATATTCATCCTGTTCCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-1242s21c1
Sequence:CCGGTATAAGCCGAAGGCATATTTGCTCGAGCAAATATGCCTTCGGCTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-385s21c1
Sequence:CCGGCGTTAGCCAAACCCAATATAACTCGAGTTATATTGGGTTTGGCTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000183.2-834s21c1
Sequence:CCGGCGACTGTCTTTAATCTCTAAACTCGAGTTTAGAGATTAAAGACAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-1932s21c1
Sequence:CCGGGTTGTCACTAAAGACTAAATGCTCGAGCATTTAGTCTTTAGTGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000183.2-530s21c1
Sequence:CCGGCCCTAAGGAAGTAGTTGATTACTCGAGTAATCAACTACTTCCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000183
VALIDATED
HADHB MISSION shRNA Lentiviral Transduction Particles
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-326s1c1
Sequence:CCGGCCTAAGGAAGTAGTTGATTATCTCGAGATAATCAACTACTTCCTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-629s1c1
Sequence:CCGGCGACTGTCTTTAATCTCTAAACTCGAGTTTAGAGATTAAAGACAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-1370s1c1
Sequence:CCGGGCCAACAGATTACGGAAAGAACTCGAGTTCTTTCCGTAATCTGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-180s1c1
Sequence:CCGGCGTTAGCCAAACCCAATATAACTCGAGTTATATTGGGTTTGGCTAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000183.1-758s1c1
Sequence:CCGGCGGCTGGAACAGGATGAATATCTCGAGATATTCATCCTGTTCCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-1242s21c1
Sequence:CCGGTATAAGCCGAAGGCATATTTGCTCGAGCAAATATGCCTTCGGCTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-385s21c1
Sequence:CCGGCGTTAGCCAAACCCAATATAACTCGAGTTATATTGGGTTTGGCTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000183.2-834s21c1
Sequence:CCGGCGACTGTCTTTAATCTCTAAACTCGAGTTTAGAGATTAAAGACAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245337    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000183.2-1932s21c1
Sequence:CCGGGTTGTCACTAAAGACTAAATGCTCGAGCATTTAGTCTTTAGTGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000183.2-530s21c1
Sequence:CCGGCCCTAAGGAAGTAGTTGATTACTCGAGTAATCAACTACTTCCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)