EMAIL THIS PAGE TO A FRIEND

HAGH

hydroxyacylglutathione hydrolase

69 Gene Product Result for
Synonyms: GLO2 GLX2 GLXII HAGH1
UniProtKB ID: Q16775, A8K290, B4DRA7
Gene ID:
Human(3029) Summary: The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(14651) hydroxyacyl glutathione hydrolase
Rat(24439) hydroxyacyl glutathione hydrolase
Zebrafish(336977) hydroxyacylglutathione hydrolase
cow(509274) hydroxyacylglutathione hydrolase
domestic cat(101085262) hydroxyacylglutathione hydrolase
dog(479888) hydroxyacylglutathione hydrolase
chicken(416537) hydroxyacylglutathione hydrolase
domestic guinea pig(100728474) hydroxyacylglutathione hydrolase
naked mole-rat(101725432) hydroxyacylglutathione hydrolase
sheep(101113118) hydroxyacylglutathione hydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024284 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024284 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024284 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005326 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040427 Rosetta Predictions human pricing
NM_005326 Rosetta Predictions human pricing
NM_033349 Rosetta Predictions rat pricing
NM_024284 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040427 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076942 predicted 1320
2 SASI_Hs01_00076943 predicted 1208
3 SASI_Hs01_00076944 predicted 814
4 SASI_Hs01_00076945 predicted 903
5 SASI_Hs01_00076946 predicted 1090
6 SASI_Hs01_00076947 predicted 1170
7 SASI_Hs01_00076948 predicted 1031
8 SASI_Hs01_00076949 predicted 979
9 SASI_Hs01_00076950 predicted 981
10 SASI_Hs01_00076951 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242618 predicted 1226
2 SASI_Hs01_00242619 predicted 1115
3 SASI_Hs01_00242620 predicted 719
4 SASI_Hs01_00242621 predicted 798
5 SASI_Hs01_00242622 predicted 992
6 SASI_Hs01_00242623 predicted 1075
7 SASI_Hs01_00242624 predicted 930
8 SASI_Hs01_00242625 predicted 888
9 SASI_Hs01_00242626 predicted 883
10 SASI_Hs01_00242627 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265534 predicted 303
2 SASI_Rn01_00054811 predicted 511
3 SASI_Rn01_00054812 predicted 252
4 SASI_Rn01_00054813 predicted 428
5 SASI_Rn01_00054814 predicted 288
6 SASI_Rn01_00054815 predicted 526
7 SASI_Rn01_00054816 predicted 350
8 SASI_Rn02_00265535 predicted 501
9 SASI_Rn01_00054819 predicted 248
10 SASI_Rn01_00054820 predicted 527
11 SASI_Rn01_00054817 predicted 330
12 SASI_Rn01_00054818 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024284 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085421 predicted 705
2 SASI_Mm01_00085422 predicted 716
3 SASI_Mm01_00085423 predicted 297
4 SASI_Mm01_00085424 predicted 570
5 SASI_Mm01_00085425 predicted 315
6 SASI_Mm01_00085428 predicted 719
7 SASI_Mm01_00085429 predicted 235
8 SASI_Mm01_00085430 predicted 261
9 SASI_Mm02_00327710 predicted 572
10 SASI_Mm02_00327711 predicted 513
11 SASI_Mm01_00085426 predicted 910
12 SASI_Mm01_00085427 predicted 829
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024284
VALIDATED
HAGH MISSION shRNA Bacterial Glycerol Stock
hydroxyacylglutathione hydrolase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-232s21c1
Sequence:CCGGGACTGTGCAGCAAGACATAATCTCGAGATTATGTCTTGCTGCACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-342s21c1
Sequence:CCGGTGCAACCACAGAAGGTTATAGCTCGAGCTATAACCTTCTGTGGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-762s21c1
Sequence:CCGGGTGGTCATGAATACACCGTAACTCGAGTTACGGTGTATTCATGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-821s21c1
Sequence:CCGGGCTGCCATTCAAGAGAAACTACTCGAGTAGTTTCTCTTGAATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-1044s21c1
Sequence:CCGGCGCTGGGACAGGGACTTCTAACTCGAGTTAGAAGTCCCTGTCCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-987s1c1
Sequence:CCGGCGCTGGGACAGGGACTTCTAACTCGAGTTAGAAGTCCCTGTCCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-579s1c1
Sequence:CCGGCTGTGTTCACAGGTGACACATCTCGAGATGTGTCACCTGTGAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-705s1c1
Sequence:CCGGGTGGTCATGAATACACCGTAACTCGAGTTACGGTGTATTCATGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-764s1c1
Sequence:CCGGGCTGCCATTCAAGAGAAACTACTCGAGTAGTTTCTCTTGAATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-706s1c1
Sequence:CCGGTGGTCATGAATACACCGTAAACTCGAGTTTACGGTGTATTCATGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024284
VALIDATED
HAGH MISSION shRNA shRNA Plasmid DNA
hydroxyacylglutathione hydrolase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-232s21c1
Sequence:CCGGGACTGTGCAGCAAGACATAATCTCGAGATTATGTCTTGCTGCACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-342s21c1
Sequence:CCGGTGCAACCACAGAAGGTTATAGCTCGAGCTATAACCTTCTGTGGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-762s21c1
Sequence:CCGGGTGGTCATGAATACACCGTAACTCGAGTTACGGTGTATTCATGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-821s21c1
Sequence:CCGGGCTGCCATTCAAGAGAAACTACTCGAGTAGTTTCTCTTGAATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-1044s21c1
Sequence:CCGGCGCTGGGACAGGGACTTCTAACTCGAGTTAGAAGTCCCTGTCCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-987s1c1
Sequence:CCGGCGCTGGGACAGGGACTTCTAACTCGAGTTAGAAGTCCCTGTCCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-579s1c1
Sequence:CCGGCTGTGTTCACAGGTGACACATCTCGAGATGTGTCACCTGTGAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-705s1c1
Sequence:CCGGGTGGTCATGAATACACCGTAACTCGAGTTACGGTGTATTCATGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-764s1c1
Sequence:CCGGGCTGCCATTCAAGAGAAACTACTCGAGTAGTTTCTCTTGAATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-706s1c1
Sequence:CCGGTGGTCATGAATACACCGTAAACTCGAGTTTACGGTGTATTCATGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024284
VALIDATED
HAGH MISSION shRNA Lentiviral Transduction Particles
hydroxyacylglutathione hydrolase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-232s21c1
Sequence:CCGGGACTGTGCAGCAAGACATAATCTCGAGATTATGTCTTGCTGCACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-342s21c1
Sequence:CCGGTGCAACCACAGAAGGTTATAGCTCGAGCTATAACCTTCTGTGGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-762s21c1
Sequence:CCGGGTGGTCATGAATACACCGTAACTCGAGTTACGGTGTATTCATGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-821s21c1
Sequence:CCGGGCTGCCATTCAAGAGAAACTACTCGAGTAGTTTCTCTTGAATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312063    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_024284.2-1044s21c1
Sequence:CCGGCGCTGGGACAGGGACTTCTAACTCGAGTTAGAAGTCCCTGTCCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101750    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-987s1c1
Sequence:CCGGCGCTGGGACAGGGACTTCTAACTCGAGTTAGAAGTCCCTGTCCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-579s1c1
Sequence:CCGGCTGTGTTCACAGGTGACACATCTCGAGATGTGTCACCTGTGAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-705s1c1
Sequence:CCGGGTGGTCATGAATACACCGTAACTCGAGTTACGGTGTATTCATGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-764s1c1
Sequence:CCGGGCTGCCATTCAAGAGAAACTACTCGAGTAGTTTCTCTTGAATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_024284.1-706s1c1
Sequence:CCGGTGGTCATGAATACACCGTAAACTCGAGTTTACGGTGTATTCATGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005326
VALIDATED
HAGH MISSION shRNA Bacterial Glycerol Stock
hydroxyacylglutathione hydrolase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-727s21c1
Sequence:CCGGATGCTGGCGGGAATGAGAAACCTCGAGGTTTCTCATTCCCGCCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-943s21c1
Sequence:CCGGTCACAGGTGACACCTTGTTTGCTCGAGCAAACAAGGTGTCACCTGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-1340s21c1
Sequence:CCGGCCCTGCACCTTCAGCGGATTTCTCGAGAAATCCGCTGAAGGTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-993s21c1
Sequence:CCGGACTGCGGATGAGATGTGTAAACTCGAGTTTACACATCTCATCCGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-878s21c1
Sequence:CCGGCCACACTTCAGGACACATTTGCTCGAGCAAATGTGTCCTGAAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-701s1c1
Sequence:CCGGCGGGAATGAGAAACTGGTCAACTCGAGTTGACCAGTTTCTCATTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-1156s1c1
Sequence:CCGGCCACCCTGGCAGAGGAGTTTACTCGAGTAAACTCCTCTGCCAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-1040s1c1
Sequence:CCGGGTACACCATCAACAACCTCAACTCGAGTTGAGGTTGTTGATGGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_005326.3-960s1c1
Sequence:CCGGACTGCGGATGAGATGTGTAAACTCGAGTTTACACATCTCATCCGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005326
VALIDATED
HAGH MISSION shRNA shRNA Plasmid DNA
hydroxyacylglutathione hydrolase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-727s21c1
Sequence:CCGGATGCTGGCGGGAATGAGAAACCTCGAGGTTTCTCATTCCCGCCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-943s21c1
Sequence:CCGGTCACAGGTGACACCTTGTTTGCTCGAGCAAACAAGGTGTCACCTGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-1340s21c1
Sequence:CCGGCCCTGCACCTTCAGCGGATTTCTCGAGAAATCCGCTGAAGGTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-993s21c1
Sequence:CCGGACTGCGGATGAGATGTGTAAACTCGAGTTTACACATCTCATCCGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-878s21c1
Sequence:CCGGCCACACTTCAGGACACATTTGCTCGAGCAAATGTGTCCTGAAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-701s1c1
Sequence:CCGGCGGGAATGAGAAACTGGTCAACTCGAGTTGACCAGTTTCTCATTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-1156s1c1
Sequence:CCGGCCACCCTGGCAGAGGAGTTTACTCGAGTAAACTCCTCTGCCAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-1040s1c1
Sequence:CCGGGTACACCATCAACAACCTCAACTCGAGTTGAGGTTGTTGATGGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_005326.3-960s1c1
Sequence:CCGGACTGCGGATGAGATGTGTAAACTCGAGTTTACACATCTCATCCGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005326
VALIDATED
HAGH MISSION shRNA Lentiviral Transduction Particles
hydroxyacylglutathione hydrolase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-727s21c1
Sequence:CCGGATGCTGGCGGGAATGAGAAACCTCGAGGTTTCTCATTCCCGCCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-943s21c1
Sequence:CCGGTCACAGGTGACACCTTGTTTGCTCGAGCAAACAAGGTGTCACCTGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-1340s21c1
Sequence:CCGGCCCTGCACCTTCAGCGGATTTCTCGAGAAATCCGCTGAAGGTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234893    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-993s21c1
Sequence:CCGGACTGCGGATGAGATGTGTAAACTCGAGTTTACACATCTCATCCGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005326.4-878s21c1
Sequence:CCGGCCACACTTCAGGACACATTTGCTCGAGCAAATGTGTCCTGAAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-701s1c1
Sequence:CCGGCGGGAATGAGAAACTGGTCAACTCGAGTTGACCAGTTTCTCATTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-1156s1c1
Sequence:CCGGCCACCCTGGCAGAGGAGTTTACTCGAGTAAACTCCTCTGCCAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005326.3-1040s1c1
Sequence:CCGGGTACACCATCAACAACCTCAACTCGAGTTGAGGTTGTTGATGGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_005326.3-960s1c1
Sequence:CCGGACTGCGGATGAGATGTGTAAACTCGAGTTTACACATCTCATCCGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)