EMAIL THIS PAGE TO A FRIEND

HAGHL

hydroxyacylglutathione hydrolase-like

82 Gene Product Result for
Gene ID:
Mouse(68977) hydroxyacylglutathione hydrolase-like
Rat(302995) hydroxyacylglutathione hydrolase-like
sheep(101111416) hydroxyacylglutathione hydrolase-like
domestic guinea pig(100722115) hydroxyacylglutathione hydrolase-like
naked mole-rat(101705933) hydroxyacylglutathione hydrolase-like
chicken(416536) hydroxyacylglutathione hydrolase-like
dog(490087) hydroxyacylglutathione hydrolase-like
cow(511836) hydroxyacylglutathione hydrolase-like
domestic cat(101087543) hydroxyacylglutathione hydrolase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032304 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014541 MISSION® esiRNA esiRNA targeting mouse Haghl (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032304 Rosetta Predictions human pricing
NM_207112 Rosetta Predictions human pricing
NM_001013114 Rosetta Predictions rat pricing
XM_001060358 Rosetta Predictions rat pricing
NM_026897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142451 predicted 464
2 SASI_Hs01_00142452 predicted 613
3 SASI_Hs01_00142453 predicted 471
4 SASI_Hs01_00142454 predicted 571
5 SASI_Hs01_00142455 predicted 562
6 SASI_Hs01_00142456 predicted 569
7 SASI_Hs01_00142457 predicted 565
8 SASI_Hs01_00142458 predicted 473
9 SASI_Hs01_00142459 predicted 586
10 SASI_Hs01_00142460 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200333 predicted 503
2 SASI_Hs01_00200334 predicted 651
3 SASI_Hs01_00200335 predicted 509
4 SASI_Hs01_00200336 predicted 606
5 SASI_Hs01_00200337 predicted 601
6 SASI_Hs01_00200338 predicted 605
7 SASI_Hs01_00200339 predicted 602
8 SASI_Hs01_00200340 predicted 506
9 SASI_Hs01_00200341 predicted 625
10 SASI_Hs01_00200342 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081052 predicted 242
2 SASI_Rn01_00081053 predicted 821
3 SASI_Rn01_00081054 predicted 390
4 SASI_Rn01_00081055 predicted 208
5 SASI_Rn01_00081056 predicted 759
6 SASI_Rn01_00081058 predicted 769
7 SASI_Rn01_00081059 predicted 815
8 SASI_Rn01_00081060 predicted 417
9 SASI_Rn02_00200803 predicted 510
10 SASI_Rn01_00081061 predicted 223
11 SASI_Rn01_00081057 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060358 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296176 predicted 384
2 SASI_Rn02_00296177 predicted 492
3 SASI_Rn02_00296178 predicted 506
4 SASI_Rn02_00296179 predicted 642
5 SASI_Rn02_00296180 predicted 603
6 SASI_Rn02_00296181 predicted 528
7 SASI_Rn02_00296182 predicted 682
8 SASI_Rn02_00296183 predicted 649
9 SASI_Rn02_00296184 predicted 602
10 SASI_Rn02_00296185 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119178 predicted 718
2 SASI_Mm01_00119179 predicted 872
3 SASI_Mm01_00119180 predicted 420
4 SASI_Mm02_00331168 predicted 228
5 SASI_Mm01_00119181 predicted 754
6 SASI_Mm02_00331169 predicted 266
7 SASI_Mm01_00119182 predicted 907
8 SASI_Mm01_00119183 predicted 826
9 SASI_Mm01_00119185 predicted 467
10 SASI_Mm01_00119186 predicted 581
11 SASI_Mm01_00119184 predicted 248
12 SASI_Mm01_00119187 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026897
HAGHL MISSION shRNA Bacterial Glycerol Stock
hydroxyacylglutathione hydrolase-like
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026897.1-1089s1c1
Sequence:CCGGGAACCGGCTTGTCCCCACACTCTCGAGAGTGTGGGGACAAGCCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-323s1c1
Sequence:CCGGGCCGAGAGGTTGCTGGAGATTCTCGAGAATCTCCAGCAACCTCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-725s1c1
Sequence:CCGGACGAAGGTGTTCTGTGGTCATCTCGAGATGACCACAGAACACCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-743s1c1
Sequence:CCGGCATGAGCATACGCTGAGCAATCTCGAGATTGCTCAGCGTATGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-830s1c1
Sequence:CCGGGAGAGGGATGACGAGGATATTCTCGAGAATATCCTCGTCATCCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-497s21c1
Sequence:CCGGATGGAGAAGGGCTTCAGTTTGCTCGAGCAAACTGAAGCCCTTCTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-558s21c1
Sequence:CCGGCTCTGGCCACATGAGCTACTTCTCGAGAAGTAGCTCATGTGGCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-386s21c1
Sequence:CCGGATCATCACTGGGACCACACACCTCGAGGTGTGTGGTCCCAGTGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026897
HAGHL MISSION shRNA shRNA Plasmid DNA
hydroxyacylglutathione hydrolase-like
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026897.1-1089s1c1
Sequence:CCGGGAACCGGCTTGTCCCCACACTCTCGAGAGTGTGGGGACAAGCCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-323s1c1
Sequence:CCGGGCCGAGAGGTTGCTGGAGATTCTCGAGAATCTCCAGCAACCTCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-725s1c1
Sequence:CCGGACGAAGGTGTTCTGTGGTCATCTCGAGATGACCACAGAACACCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-743s1c1
Sequence:CCGGCATGAGCATACGCTGAGCAATCTCGAGATTGCTCAGCGTATGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-830s1c1
Sequence:CCGGGAGAGGGATGACGAGGATATTCTCGAGAATATCCTCGTCATCCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-497s21c1
Sequence:CCGGATGGAGAAGGGCTTCAGTTTGCTCGAGCAAACTGAAGCCCTTCTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-558s21c1
Sequence:CCGGCTCTGGCCACATGAGCTACTTCTCGAGAAGTAGCTCATGTGGCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-386s21c1
Sequence:CCGGATCATCACTGGGACCACACACCTCGAGGTGTGTGGTCCCAGTGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026897
HAGHL MISSION shRNA Lentiviral Transduction Particles
hydroxyacylglutathione hydrolase-like
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026897.1-1089s1c1
Sequence:CCGGGAACCGGCTTGTCCCCACACTCTCGAGAGTGTGGGGACAAGCCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-323s1c1
Sequence:CCGGGCCGAGAGGTTGCTGGAGATTCTCGAGAATCTCCAGCAACCTCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-725s1c1
Sequence:CCGGACGAAGGTGTTCTGTGGTCATCTCGAGATGACCACAGAACACCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-743s1c1
Sequence:CCGGCATGAGCATACGCTGAGCAATCTCGAGATTGCTCAGCGTATGCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026897.1-830s1c1
Sequence:CCGGGAGAGGGATGACGAGGATATTCTCGAGAATATCCTCGTCATCCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-497s21c1
Sequence:CCGGATGGAGAAGGGCTTCAGTTTGCTCGAGCAAACTGAAGCCCTTCTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-558s21c1
Sequence:CCGGCTCTGGCCACATGAGCTACTTCTCGAGAAGTAGCTCATGTGGCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026897.2-386s21c1
Sequence:CCGGATCATCACTGGGACCACACACCTCGAGGTGTGTGGTCCCAGTGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032304
HAGHL MISSION shRNA Bacterial Glycerol Stock
hydroxyacylglutathione hydrolase-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-767s1c1
Sequence:CCGGACGCTTAGCAACCTGGAGTTTCTCGAGAAACTCCAGGTTGCTAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-826s1c1
Sequence:CCGGCAAGCTGTCCTGGGCTAAGAACTCGAGTTCTTAGCCCAGGACAGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-388s1c1
Sequence:CCGGCGCTGTGCTGACCACCCACCACTCGAGTGGTGGGTGGTCAGCACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-594s1c1
Sequence:CCGGACTTCCTGTGGGAGGACGATTCTCGAGAATCGTCCTCCCACAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-757s1c1
Sequence:CCGGCCACGAGCACACGCTTAGCAACTCGAGTTGCTAAGCGTGTGCTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032304.2-582s21c1
Sequence:CCGAGCCACATGAGCTACTTCCTGTCTCGAGACAGGAAGTAGCTCATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032304.2-284s21c1
Sequence:CCGGATGTACCTGGTCATCGAGGAGCTCGAGCTCCTCGATGACCAGGTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032304
HAGHL MISSION shRNA shRNA Plasmid DNA
hydroxyacylglutathione hydrolase-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-767s1c1
Sequence:CCGGACGCTTAGCAACCTGGAGTTTCTCGAGAAACTCCAGGTTGCTAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-826s1c1
Sequence:CCGGCAAGCTGTCCTGGGCTAAGAACTCGAGTTCTTAGCCCAGGACAGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-388s1c1
Sequence:CCGGCGCTGTGCTGACCACCCACCACTCGAGTGGTGGGTGGTCAGCACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-594s1c1
Sequence:CCGGACTTCCTGTGGGAGGACGATTCTCGAGAATCGTCCTCCCACAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-757s1c1
Sequence:CCGGCCACGAGCACACGCTTAGCAACTCGAGTTGCTAAGCGTGTGCTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032304.2-582s21c1
Sequence:CCGAGCCACATGAGCTACTTCCTGTCTCGAGACAGGAAGTAGCTCATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032304.2-284s21c1
Sequence:CCGGATGTACCTGGTCATCGAGGAGCTCGAGCTCCTCGATGACCAGGTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032304
HAGHL MISSION shRNA Lentiviral Transduction Particles
hydroxyacylglutathione hydrolase-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-767s1c1
Sequence:CCGGACGCTTAGCAACCTGGAGTTTCTCGAGAAACTCCAGGTTGCTAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-826s1c1
Sequence:CCGGCAAGCTGTCCTGGGCTAAGAACTCGAGTTCTTAGCCCAGGACAGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-388s1c1
Sequence:CCGGCGCTGTGCTGACCACCCACCACTCGAGTGGTGGGTGGTCAGCACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-594s1c1
Sequence:CCGGACTTCCTGTGGGAGGACGATTCTCGAGAATCGTCCTCCCACAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032304.2-757s1c1
Sequence:CCGGCCACGAGCACACGCTTAGCAACTCGAGTTGCTAAGCGTGTGCTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032304.2-582s21c1
Sequence:CCGAGCCACATGAGCTACTTCCTGTCTCGAGACAGGAAGTAGCTCATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032304.2-284s21c1
Sequence:CCGGATGTACCTGGTCATCGAGGAGCTCGAGCTCCTCGATGACCAGGTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)