EMAIL THIS PAGE TO A FRIEND

HAL

histidine ammonia-lyase

53 Gene Product Result for
Synonyms: HIS HSTD
Gene ID:
Human(3034) Summary: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(15109) histidine ammonia lyase
Rat(29301) histidine ammonia lyase
Zebrafish(100004331) histidine ammonia-lyase
domestic cat(101083689) histidine ammonia-lyase
cow(615205) histidine ammonia-lyase
dog(475433) histidine ammonia-lyase
chicken(378924) histidine ammonia-lyase
domestic guinea pig(100719999) histidine ammonia-lyase
naked mole-rat(101698826) histidine ammonia-lyase
sheep(101119036) histidine ammonia-lyase
Domestic Rabbit(100357471) histidine ammonia-lyase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002108 Rosetta Predictions human pricing
NM_017159 Rosetta Predictions rat pricing
NM_010401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075014 predicted 2340
2 SASI_Hs01_00075015 predicted 736
3 SASI_Hs01_00075016 predicted 300
4 SASI_Hs01_00075017 predicted 1155
5 SASI_Hs01_00075019 predicted 637
6 SASI_Hs01_00075020 predicted 1412
7 SASI_Hs01_00075021 predicted 1343
8 SASI_Hs02_00333224 predicted 950
9 SASI_Hs01_00075022 predicted 977
10 SASI_Hs01_00075023 predicted 1547
11 SASI_Hs01_00075018 predicted 2161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114389 predicted 265
2 SASI_Rn01_00114390 predicted 697
3 SASI_Rn01_00114392 predicted 910
4 SASI_Rn01_00114393 predicted 1227
5 SASI_Rn01_00114394 predicted 1480
6 SASI_Rn01_00114395 predicted 1161
7 SASI_Rn01_00114397 predicted 1381
8 SASI_Rn02_00261463 predicted 1265
9 SASI_Rn01_00114398 predicted 875
10 SASI_Rn02_00261464 predicted 486
11 SASI_Rn01_00114391 predicted 1767
12 SASI_Rn01_00114396 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189324 predicted 756
2 SASI_Mm02_00318521 predicted 1229
3 SASI_Mm01_00189326 predicted 2276
4 SASI_Mm01_00189327 predicted 1740
5 SASI_Mm01_00189328 predicted 623
6 SASI_Mm01_00189329 predicted 1635
7 SASI_Mm01_00189330 predicted 1828
8 SASI_Mm01_00189331 predicted 841
9 SASI_Mm01_00189332 predicted 900
10 SASI_Mm01_00189333 predicted 2151
11 SASI_Mm01_00189325 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002108
HAL MISSION shRNA Bacterial Glycerol Stock
histidine ammonia-lyase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002108.2-750s21c1
Sequence:CCGGGGTCATAGATAGCATCATAAACTCGAGTTTATGATGCTATCTATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-983s1c2
Sequence:CCGGCCCTCAAACAAGTCATAGAAACTCGAGTTTCTATGACTTGTTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-568s1c1
Sequence:CCGGCCTGACTTCATTCCATCTCAACTCGAGTTGAGATGGAATGAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002108.2-1510s21c1
Sequence:CCGGGGTGTGGTGAATGATACAATACTCGAGTATTGTATCATTCACCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-1673s1c1
Sequence:CCGGGCATCCATGAACTTGCTGCAACTCGAGTTGCAGCAAGTTCATGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002108.2-2744s1c1
Sequence:CCGGGCCTTAATATGCCTTCATAAACTCGAGTTTATGAAGGCATATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-953s1c1
Sequence:CCGGCCAAAGGATACAGTGGCATTTCTCGAGAAATGCCACTGTATCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002108
HAL MISSION shRNA shRNA Plasmid DNA
histidine ammonia-lyase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002108.2-750s21c1
Sequence:CCGGGGTCATAGATAGCATCATAAACTCGAGTTTATGATGCTATCTATGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-983s1c2
Sequence:CCGGCCCTCAAACAAGTCATAGAAACTCGAGTTTCTATGACTTGTTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-568s1c1
Sequence:CCGGCCTGACTTCATTCCATCTCAACTCGAGTTGAGATGGAATGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002108.2-1510s21c1
Sequence:CCGGGGTGTGGTGAATGATACAATACTCGAGTATTGTATCATTCACCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-1673s1c1
Sequence:CCGGGCATCCATGAACTTGCTGCAACTCGAGTTGCAGCAAGTTCATGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002108.2-2744s1c1
Sequence:CCGGGCCTTAATATGCCTTCATAAACTCGAGTTTATGAAGGCATATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-953s1c1
Sequence:CCGGCCAAAGGATACAGTGGCATTTCTCGAGAAATGCCACTGTATCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002108
HAL MISSION shRNA Lentiviral Transduction Particles
histidine ammonia-lyase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002108.2-750s21c1
Sequence:CCGGGGTCATAGATAGCATCATAAACTCGAGTTTATGATGCTATCTATGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-983s1c2
Sequence:CCGGCCCTCAAACAAGTCATAGAAACTCGAGTTTCTATGACTTGTTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-568s1c1
Sequence:CCGGCCTGACTTCATTCCATCTCAACTCGAGTTGAGATGGAATGAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002108.2-1510s21c1
Sequence:CCGGGGTGTGGTGAATGATACAATACTCGAGTATTGTATCATTCACCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-1673s1c1
Sequence:CCGGGCATCCATGAACTTGCTGCAACTCGAGTTGCAGCAAGTTCATGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002108.2-2744s1c1
Sequence:CCGGGCCTTAATATGCCTTCATAAACTCGAGTTTATGAAGGCATATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002108.2-953s1c1
Sequence:CCGGCCAAAGGATACAGTGGCATTTCTCGAGAAATGCCACTGTATCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010401
HAL MISSION shRNA Bacterial Glycerol Stock
histidine ammonia-lyase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-1018s1c1
Sequence:CCGGGCCAAAGGTTACAGTGGGATTCTCGAGAATCCCACTGTAACCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-1754s1c1
Sequence:CCGGCGGCAATTAGTGAAAGAAGAACTCGAGTTCTTCTTTCACTAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-459s1c1
Sequence:CCGGGCGACGCTACATGAAGAACAACTCGAGTTGTTCTTCATGTAGCGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010401.3-2608s1c1
Sequence:CCGGCAGCCACAATTCCATAGGTTTCTCGAGAAACCTATGGAATTGTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-2211s1c1
Sequence:CCGGCGCACCGTACATCGAGAAATACTCGAGTATTTCTCGATGTACGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010401
HAL MISSION shRNA shRNA Plasmid DNA
histidine ammonia-lyase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-1018s1c1
Sequence:CCGGGCCAAAGGTTACAGTGGGATTCTCGAGAATCCCACTGTAACCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-1754s1c1
Sequence:CCGGCGGCAATTAGTGAAAGAAGAACTCGAGTTCTTCTTTCACTAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-459s1c1
Sequence:CCGGGCGACGCTACATGAAGAACAACTCGAGTTGTTCTTCATGTAGCGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010401.3-2608s1c1
Sequence:CCGGCAGCCACAATTCCATAGGTTTCTCGAGAAACCTATGGAATTGTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-2211s1c1
Sequence:CCGGCGCACCGTACATCGAGAAATACTCGAGTATTTCTCGATGTACGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010401
HAL MISSION shRNA Lentiviral Transduction Particles
histidine ammonia-lyase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-1018s1c1
Sequence:CCGGGCCAAAGGTTACAGTGGGATTCTCGAGAATCCCACTGTAACCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-1754s1c1
Sequence:CCGGCGGCAATTAGTGAAAGAAGAACTCGAGTTCTTCTTTCACTAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-459s1c1
Sequence:CCGGGCGACGCTACATGAAGAACAACTCGAGTTGTTCTTCATGTAGCGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010401.3-2608s1c1
Sequence:CCGGCAGCCACAATTCCATAGGTTTCTCGAGAAACCTATGGAATTGTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010401.3-2211s1c1
Sequence:CCGGCGCACCGTACATCGAGAAATACTCGAGTATTTCTCGATGTACGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)