EMAIL THIS PAGE TO A FRIEND

HAMP

hepcidin antimicrobial peptide

37 Gene Product Result for
Synonyms: HEPC HFE2B LEAP1 PLTR
UniProtKB ID: P81172, Q1HE14, Q9BY68
Gene ID:
Human(57817) Summary: The product encoded by this gene is involved in the maintenance of iron homeostasis, and it is necessary for the regulation of iron storage in macrophages, and for intestinal iron absorption. The preproprotein is post-translationally cleaved into mature peptides of 20, 22 and 25 amino acids, and these active peptides are rich in cysteines, which form intramolecular bonds that stabilize their beta-sheet structures. These peptides exhibit antimicrobial activity. Mutations in this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis, a disease caused by severe iron overload that results in cardiomyopathy, cirrhosis, and endocrine failure. [provided by RefSeq, Jul 2008]
Mouse(84506) hepcidin antimicrobial peptide
Rat(84604) hepcidin antimicrobial peptide
domestic cat(101084332) hepcidin antimicrobial peptide
Horse(100050728) hepcidin antimicrobial peptide
cow(512301) hepcidin antimicrobial peptide
dog(492281) hepcidin antimicrobial peptide
sheep(100500730) hepcidin antimicrobial peptide
domestic guinea pig(100733490) hepcidin antimicrobial peptide
naked mole-rat(101700964) hepcidin antimicrobial peptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021175 Rosetta Predictions human pricing
NM_053469 Rosetta Predictions rat pricing
NM_032541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354736 predicted 205
2 SASI_Hs01_00118786 predicted 157
3 SASI_Hs01_00118787 predicted 279
4 SASI_Hs02_00354737 predicted 296
5 SASI_Hs01_00118789 predicted 275
6 SASI_Hs01_00118790 predicted 124
7 SASI_Hs01_00118791 predicted 372
8 SASI_Hs01_00118792 predicted 279
9 SASI_Hs01_00118793 predicted 122
10 SASI_Hs01_00118794 predicted 269
11 SASI_Hs01_00118788 predicted 216
12 SASI_Hs01_00118795 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089027 predicted 174
2 SASI_Rn01_00089028 predicted 246
3 SASI_Rn01_00089029 predicted 86
4 SASI_Rn01_00089030 predicted 287
5 SASI_Rn01_00089031 predicted 143
6 SASI_Rn01_00089032 predicted 279
7 SASI_Rn01_00089033 predicted 32
8 SASI_Rn01_00089034 predicted 84
9 SASI_Rn01_00089036 predicted 252
10 SASI_Rn02_00266061 predicted 115
11 SASI_Rn01_00089035 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042241 predicted 233
2 SASI_Mm01_00042242 predicted 232
3 SASI_Mm01_00042243 predicted 256
4 SASI_Mm01_00042244 predicted 226
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032541
HAMP MISSION shRNA Bacterial Glycerol Stock
hepcidin antimicrobial peptide
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-225s1c1
Sequence:CCGGTCTGCATCTTCTGCTGTAAATCTCGAGATTTACAGCAGAAGATGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-180s1c1
Sequence:CCGGCGATACCAATGCAGAAGAGAACTCGAGTTCTCTTCTGCATTGGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-245s1c1
Sequence:CCGGTGCTGTAACAATTCCCAGTGTCTCGAGACACTGGGAATTGTTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-236s1c1
Sequence:CCGGTGCTGTAAATGCTGTAACAATCTCGAGATTGTTACAGCATTTACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032541.1-200s21c1
Sequence:CCGGAGGAAGAGAGACACCAACTTCCTCGAGGAAGTTGGTGTCTCTCTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032541.1-131s21c1
Sequence:CCGGACTACAGAGCTGCAGCCTTTGCTCGAGCAAAGGCTGCAGCTCTGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032541
HAMP MISSION shRNA shRNA Plasmid DNA
hepcidin antimicrobial peptide
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-225s1c1
Sequence:CCGGTCTGCATCTTCTGCTGTAAATCTCGAGATTTACAGCAGAAGATGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-180s1c1
Sequence:CCGGCGATACCAATGCAGAAGAGAACTCGAGTTCTCTTCTGCATTGGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-245s1c1
Sequence:CCGGTGCTGTAACAATTCCCAGTGTCTCGAGACACTGGGAATTGTTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-236s1c1
Sequence:CCGGTGCTGTAAATGCTGTAACAATCTCGAGATTGTTACAGCATTTACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032541.1-200s21c1
Sequence:CCGGAGGAAGAGAGACACCAACTTCCTCGAGGAAGTTGGTGTCTCTCTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032541.1-131s21c1
Sequence:CCGGACTACAGAGCTGCAGCCTTTGCTCGAGCAAAGGCTGCAGCTCTGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032541
HAMP MISSION shRNA Lentiviral Transduction Particles
hepcidin antimicrobial peptide
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-225s1c1
Sequence:CCGGTCTGCATCTTCTGCTGTAAATCTCGAGATTTACAGCAGAAGATGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-180s1c1
Sequence:CCGGCGATACCAATGCAGAAGAGAACTCGAGTTCTCTTCTGCATTGGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-245s1c1
Sequence:CCGGTGCTGTAACAATTCCCAGTGTCTCGAGACACTGGGAATTGTTACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032541.1-236s1c1
Sequence:CCGGTGCTGTAAATGCTGTAACAATCTCGAGATTGTTACAGCATTTACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032541.1-200s21c1
Sequence:CCGGAGGAAGAGAGACACCAACTTCCTCGAGGAAGTTGGTGTCTCTCTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032541.1-131s21c1
Sequence:CCGGACTACAGAGCTGCAGCCTTTGCTCGAGCAAAGGCTGCAGCTCTGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021175
HAMP MISSION shRNA Bacterial Glycerol Stock
hepcidin antimicrobial peptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-197s1c1
Sequence:CCGGCCAGAGGCGAAGGAGGCGAGACTCGAGTCTCGCCTCCTTCGCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-189s21c1
Sequence:CCGGCAGGACAGAGCTGGAGCCAGGCTCGAGCCTGGCTCCAGCTCTGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-129s21c1
Sequence:CCGGAGCCTGACCAGTGGCTCTGTTCTCGAGAACAGAGCCACTGGTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-223s21c1
Sequence:CCGGCCATGTTCCAGAGGCGAAGGACTCGAGTCCTTCGCCTCTGGAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-93s1c1
Sequence:CCGGGCCAGCCTGACCAGTGGCTCTCTCGAGAGAGCCACTGGTCAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-65s1c1
Sequence:CCGGCGCTTGCCTCCTGCTCCTCCTCTCGAGAGGAGGAGCAGGAGGCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-212s21c1
Sequence:CCGGCAGCTGGATGCCCATGTTCCACTCGAGTGGAACATGGGCATCCAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-153s21c1
Sequence:CCGGCCACAACAGACGGGACAACTTCTCGAGAAGTTGTCCCGTCTGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-115s21c1
Sequence:CCGGTCCTCCTCCTCGCCAGCCTGACTCGAGTCAGGCTGGCGAGGAGGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021175
HAMP MISSION shRNA shRNA Plasmid DNA
hepcidin antimicrobial peptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-197s1c1
Sequence:CCGGCCAGAGGCGAAGGAGGCGAGACTCGAGTCTCGCCTCCTTCGCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-189s21c1
Sequence:CCGGCAGGACAGAGCTGGAGCCAGGCTCGAGCCTGGCTCCAGCTCTGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-129s21c1
Sequence:CCGGAGCCTGACCAGTGGCTCTGTTCTCGAGAACAGAGCCACTGGTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-223s21c1
Sequence:CCGGCCATGTTCCAGAGGCGAAGGACTCGAGTCCTTCGCCTCTGGAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-93s1c1
Sequence:CCGGGCCAGCCTGACCAGTGGCTCTCTCGAGAGAGCCACTGGTCAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-65s1c1
Sequence:CCGGCGCTTGCCTCCTGCTCCTCCTCTCGAGAGGAGGAGCAGGAGGCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-212s21c1
Sequence:CCGGCAGCTGGATGCCCATGTTCCACTCGAGTGGAACATGGGCATCCAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-153s21c1
Sequence:CCGGCCACAACAGACGGGACAACTTCTCGAGAAGTTGTCCCGTCTGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-115s21c1
Sequence:CCGGTCCTCCTCCTCGCCAGCCTGACTCGAGTCAGGCTGGCGAGGAGGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021175
HAMP MISSION shRNA Lentiviral Transduction Particles
hepcidin antimicrobial peptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-197s1c1
Sequence:CCGGCCAGAGGCGAAGGAGGCGAGACTCGAGTCTCGCCTCCTTCGCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-189s21c1
Sequence:CCGGCAGGACAGAGCTGGAGCCAGGCTCGAGCCTGGCTCCAGCTCTGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-129s21c1
Sequence:CCGGAGCCTGACCAGTGGCTCTGTTCTCGAGAACAGAGCCACTGGTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-223s21c1
Sequence:CCGGCCATGTTCCAGAGGCGAAGGACTCGAGTCCTTCGCCTCTGGAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-93s1c1
Sequence:CCGGGCCAGCCTGACCAGTGGCTCTCTCGAGAGAGCCACTGGTCAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021175.1-65s1c1
Sequence:CCGGCGCTTGCCTCCTGCTCCTCCTCTCGAGAGGAGGAGCAGGAGGCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-212s21c1
Sequence:CCGGCAGCTGGATGCCCATGTTCCACTCGAGTGGAACATGGGCATCCAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-153s21c1
Sequence:CCGGCCACAACAGACGGGACAACTTCTCGAGAAGTTGTCCCGTCTGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021175.2-115s21c1
Sequence:CCGGTCCTCCTCCTCGCCAGCCTGACTCGAGTCAGGCTGGCGAGGAGGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)