EMAIL THIS PAGE TO A FRIEND

HAND1

heart and neural crest derivatives expressed 1

53 Gene Product Result for
Synonyms: Hxt Thing1 bHLHa27 eHand
UniProtKB ID: O96004
Gene ID:
Human(9421) Summary: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, it has been suggested that this transcription factor may be required for early trophoblast differentiation. [provided by RefSeq, Jul 2008]
Mouse(15110) heart and neural crest derivatives expressed transcript 1
Rat(59112) heart and neural crest derivatives expressed 1
chicken(395812) heart and neural crest derivatives expressed 1
dog(489164) heart and neural crest derivatives expressed 1
cow(517952) heart and neural crest derivatives expressed 1
domestic cat(101096445) heart and neural crest derivatives expressed 1
sheep(443353) heart and neural crest derivatives expressed 1
domestic guinea pig(100722914) heart and neural crest derivatives expressed 1
naked mole-rat(101721169) heart and neural crest derivatives expressed 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1500 Human HAND1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004821 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152461 MISSION® esiRNA esiRNA human HAND1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004821 Rosetta Predictions human pricing
NM_021592 Rosetta Predictions rat pricing
NM_008213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338386 predicted 825
2 SASI_Hs01_00170649 predicted 768
3 SASI_Hs01_00170652 predicted 850
4 SASI_Hs01_00170653 predicted 851
5 SASI_Hs01_00170654 predicted 727
6 SASI_Hs01_00170655 predicted 825
7 SASI_Hs01_00170656 predicted 726
8 SASI_Hs01_00170657 predicted 762
9 SASI_Hs01_00170658 predicted 720
10 SASI_Hs02_00338387 predicted 863
11 SASI_Hs01_00170650 predicted 736
12 SASI_Hs01_00170651 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049586 predicted 322
2 SASI_Rn01_00049587 predicted 838
3 SASI_Rn01_00049588 predicted 622
4 SASI_Rn01_00049589 predicted 785
5 SASI_Rn01_00049590 predicted 274
6 SASI_Rn01_00049591 predicted 708
7 SASI_Rn01_00049592 predicted 825
8 SASI_Rn01_00049593 predicted 432
9 SASI_Rn01_00049594 predicted 626
10 SASI_Rn01_00049595 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125762 predicted 1254
2 SASI_Mm01_00125759 predicted 369
3 SASI_Mm01_00125761 predicted 1173
4 SASI_Mm01_00125763 predicted 769
5 SASI_Mm02_00313381 predicted 862
6 SASI_Mm01_00125764 predicted 776
7 SASI_Mm01_00125767 predicted 974
8 SASI_Mm01_00125768 predicted 1312
9 SASI_Mm02_00313382 predicted 1072
10 SASI_Mm02_00313383 predicted 420
11 SASI_Mm01_00125760 predicted 1214
12 SASI_Mm01_00125765 predicted 1114
13 SASI_Mm01_00125766 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004821
VALIDATED
HAND1 MISSION shRNA Bacterial Glycerol Stock
heart and neural crest derivatives expressed 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004821.1-351s1c1
Sequence:CCGGCCTCGCGCTGTCATCAGGAAACTCGAGTTTCCTGATGACAGCGCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-1461s1c1
Sequence:CCGGCCTGTTTAGTTCCAAGGGAAACTCGAGTTTCCCTTGGAACTAAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-832s1c1
Sequence:CCGGCCCAGTCGAGAAGAGGATTAACTCGAGTTAATCCTCTTCTCGACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-361s1c1
Sequence:CCGGTCATCAGGAAAGGCCCTACTTCTCGAGAAGTAGGGCCTTTCCTGATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004821.1-577s1c1
Sequence:CCGGTGAGAGCATTAACAGCGCATTCTCGAGAATGCGCTGTTAATGCTCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004821.2-1313s21c1
Sequence:CCGGCGACGCCGTCTTCTCTAATTACTCGAGTAATTAGAGAAGACGGCGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004821.2-878s21c1
Sequence:CCGGGTCTGGGCGCTGGAGTTAAACCTCGAGGTTTAACTCCAGCGCCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004821
VALIDATED
HAND1 MISSION shRNA shRNA Plasmid DNA
heart and neural crest derivatives expressed 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004821.1-351s1c1
Sequence:CCGGCCTCGCGCTGTCATCAGGAAACTCGAGTTTCCTGATGACAGCGCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-1461s1c1
Sequence:CCGGCCTGTTTAGTTCCAAGGGAAACTCGAGTTTCCCTTGGAACTAAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-832s1c1
Sequence:CCGGCCCAGTCGAGAAGAGGATTAACTCGAGTTAATCCTCTTCTCGACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-361s1c1
Sequence:CCGGTCATCAGGAAAGGCCCTACTTCTCGAGAAGTAGGGCCTTTCCTGATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004821.1-577s1c1
Sequence:CCGGTGAGAGCATTAACAGCGCATTCTCGAGAATGCGCTGTTAATGCTCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004821.2-1313s21c1
Sequence:CCGGCGACGCCGTCTTCTCTAATTACTCGAGTAATTAGAGAAGACGGCGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004821.2-878s21c1
Sequence:CCGGGTCTGGGCGCTGGAGTTAAACCTCGAGGTTTAACTCCAGCGCCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004821
VALIDATED
HAND1 MISSION shRNA Lentiviral Transduction Particles
heart and neural crest derivatives expressed 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004821.1-351s1c1
Sequence:CCGGCCTCGCGCTGTCATCAGGAAACTCGAGTTTCCTGATGACAGCGCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013433    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-1461s1c1
Sequence:CCGGCCTGTTTAGTTCCAAGGGAAACTCGAGTTTCCCTTGGAACTAAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-832s1c1
Sequence:CCGGCCCAGTCGAGAAGAGGATTAACTCGAGTTAATCCTCTTCTCGACTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004821.1-361s1c1
Sequence:CCGGTCATCAGGAAAGGCCCTACTTCTCGAGAAGTAGGGCCTTTCCTGATGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004821.1-577s1c1
Sequence:CCGGTGAGAGCATTAACAGCGCATTCTCGAGAATGCGCTGTTAATGCTCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004821.2-1313s21c1
Sequence:CCGGCGACGCCGTCTTCTCTAATTACTCGAGTAATTAGAGAAGACGGCGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004821.2-878s21c1
Sequence:CCGGGTCTGGGCGCTGGAGTTAAACCTCGAGGTTTAACTCCAGCGCCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008213
HAND1 MISSION shRNA Bacterial Glycerol Stock
heart and neural crest derivatives expressed 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-781s1c1
Sequence:CCGGCAGTTACATCGCCTACTTGATCTCGAGATCAAGTAGGCGATGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008213.1-1731s1c1
Sequence:CCGGCGTTGCTGAATTTGTAACGTACTCGAGTACGTTACAAATTCAGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-682s1c1
Sequence:CCGGAGAGAGCATTAACAGCGCGTTCTCGAGAACGCGCTGTTAATGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-842s1c1
Sequence:CCGGGCCTTCAAGGCTGAACTCAAACTCGAGTTTGAGTTCAGCCTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-566s1c1
Sequence:CCGGGCGGCTGCCTATGGTCCCGATCTCGAGATCGGGACCATAGGCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008213.2-1444s21c1
Sequence:CCGGATAAGAGTAATTGGTAGTTTCCTCGAGGAAACTACCAATTACTCTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008213.2-1179s21c1
Sequence:CCGGATCGCACGTGCAATGTCATTTCTCGAGAAATGACATTGCACGTGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008213.2-985s21c1
Sequence:CCGGAGTCTGGGCGCTGGAGCTAAACTCGAGTTTAGCTCCAGCGCCCAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008213
HAND1 MISSION shRNA shRNA Plasmid DNA
heart and neural crest derivatives expressed 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-781s1c1
Sequence:CCGGCAGTTACATCGCCTACTTGATCTCGAGATCAAGTAGGCGATGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008213.1-1731s1c1
Sequence:CCGGCGTTGCTGAATTTGTAACGTACTCGAGTACGTTACAAATTCAGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-682s1c1
Sequence:CCGGAGAGAGCATTAACAGCGCGTTCTCGAGAACGCGCTGTTAATGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-842s1c1
Sequence:CCGGGCCTTCAAGGCTGAACTCAAACTCGAGTTTGAGTTCAGCCTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-566s1c1
Sequence:CCGGGCGGCTGCCTATGGTCCCGATCTCGAGATCGGGACCATAGGCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008213.2-1444s21c1
Sequence:CCGGATAAGAGTAATTGGTAGTTTCCTCGAGGAAACTACCAATTACTCTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008213.2-1179s21c1
Sequence:CCGGATCGCACGTGCAATGTCATTTCTCGAGAAATGACATTGCACGTGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008213.2-985s21c1
Sequence:CCGGAGTCTGGGCGCTGGAGCTAAACTCGAGTTTAGCTCCAGCGCCCAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008213
HAND1 MISSION shRNA Lentiviral Transduction Particles
heart and neural crest derivatives expressed 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-781s1c1
Sequence:CCGGCAGTTACATCGCCTACTTGATCTCGAGATCAAGTAGGCGATGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008213.1-1731s1c1
Sequence:CCGGCGTTGCTGAATTTGTAACGTACTCGAGTACGTTACAAATTCAGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-682s1c1
Sequence:CCGGAGAGAGCATTAACAGCGCGTTCTCGAGAACGCGCTGTTAATGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-842s1c1
Sequence:CCGGGCCTTCAAGGCTGAACTCAAACTCGAGTTTGAGTTCAGCCTTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008213.1-566s1c1
Sequence:CCGGGCGGCTGCCTATGGTCCCGATCTCGAGATCGGGACCATAGGCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008213.2-1444s21c1
Sequence:CCGGATAAGAGTAATTGGTAGTTTCCTCGAGGAAACTACCAATTACTCTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008213.2-1179s21c1
Sequence:CCGGATCGCACGTGCAATGTCATTTCTCGAGAAATGACATTGCACGTGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008213.2-985s21c1
Sequence:CCGGAGTCTGGGCGCTGGAGCTAAACTCGAGTTTAGCTCCAGCGCCCAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)