EMAIL THIS PAGE TO A FRIEND

HAND2

heart and neural crest derivatives expressed 2

130 Gene Product Result for
Synonyms: DHAND2 Hed Thing2 bHLHa26 dHand
UniProtKB ID: P61296, B6ECG9, O95300, O95301, P97833
Gene ID:
Human(9464) Summary: The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]
Mouse(15111) heart and neural crest derivatives expressed transcript 2
Rat(64637) heart and neural crest derivatives expressed 2
domestic guinea pig(100726553) heart and neural crest derivatives expressed 2
naked mole-rat(101712394) heart and neural crest derivatives expressed 2
sheep(101120384) heart and neural crest derivatives expressed 2
Zebrafish(58150) heart and neural crest derivatives expressed transcript 2
dog(607431) heart and neural crest derivatives expressed 2
cow(781874) heart and neural crest derivatives expressed 2
domestic cat(101091104) heart and neural crest derivatives expressed 2
chicken(395813) heart and neural crest derivatives expressed 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010402 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010402 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010402 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021973 Rosetta Predictions human pricing
NM_022696 Rosetta Predictions rat pricing
NM_010402 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045569 predicted 1997
2 SASI_Hs01_00045570 predicted 1996
3 SASI_Hs01_00045571 predicted 2009
4 SASI_Hs01_00045572 predicted 2004
5 SASI_Hs01_00045573 predicted 2002
6 SASI_Hs01_00045574 predicted 2020
7 SASI_Hs01_00045575 predicted 2013
8 SASI_Hs01_00045576 predicted 2001
9 SASI_Hs01_00045577 predicted 1994
10 SASI_Hs01_00045578 predicted 2017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083863 predicted 349
2 SASI_Rn01_00083864 predicted 240
3 SASI_Rn01_00083866 predicted 356
4 SASI_Rn02_00263492 predicted 247
5 SASI_Rn01_00083867 predicted 240
6 SASI_Rn01_00083868 predicted 206
7 SASI_Rn01_00083870 predicted 416
8 SASI_Rn01_00083871 predicted 204
9 SASI_Rn02_00263493 predicted 348
10 SASI_Rn02_00263494 predicted 342
11 SASI_Rn01_00083862 predicted 416
12 SASI_Rn01_00083865 predicted 415
13 SASI_Rn01_00083869 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318522 predicted 1937
2 SASI_Mm02_00318523 predicted 1666
3 SASI_Mm02_00318524 predicted 1947
4 SASI_Mm02_00318525 predicted 1684
5 SASI_Mm02_00318526 predicted 1462
6 SASI_Mm02_00318527 predicted 1868
7 SASI_Mm02_00318528 predicted 1667
8 SASI_Mm02_00318529 predicted 1648
9 SASI_Mm02_00318530 predicted 1661
10 SASI_Mm02_00318531 predicted 1655
11 SASI_Mm01_00134180 predicted 329
12 SASI_Mm01_00134181 predicted 327
13 SASI_Mm01_00134182 predicted 331
14 SASI_Mm01_00134183 predicted 424
15 SASI_Mm01_00134184 predicted 330
16 SASI_Mm01_00134185 predicted 441
17 SASI_Mm01_00134186 predicted 329
18 SASI_Mm01_00134187 predicted 326
19 SASI_Mm01_00134188 predicted 444
20 SASI_Mm01_00134189 predicted 451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021973
HAND2 MISSION shRNA Bacterial Glycerol Stock
heart and neural crest derivatives expressed 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021973.2-2004s21c1
Sequence:CCGGTACTTGGCCTTTGGATATAAACTCGAGTTTATATCCAAAGGCCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021973.1-930s1c1
Sequence:CCGGCCGGTTTATTTATGTGCAATTCTCGAGAATTGCACATAAATAAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-489s1c1
Sequence:CCGGTCAGAGCATCAACAGCGCCTTCTCGAGAAGGCGCTGTTGATGCTCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-663s1c1
Sequence:CCGGGATCAAGAAGACCGACGTGAACTCGAGTTCACGTCGGTCTTCTTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-726s1c1
Sequence:CCGGCACAGTGAGCAGCAACGACAACTCGAGTTGTCGTTGCTGCTCACTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-276s1c1
Sequence:CCGGCTACTTCCATGGCTGGCTCATCTCGAGATGAGCCAGCCATGGAAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021973.2-1488s21c1
Sequence:CCGGGAGCTGAACGAAATCTTGAAACTCGAGTTTCAAGATTTCGTTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021973
HAND2 MISSION shRNA shRNA Plasmid DNA
heart and neural crest derivatives expressed 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021973.2-2004s21c1
Sequence:CCGGTACTTGGCCTTTGGATATAAACTCGAGTTTATATCCAAAGGCCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021973.1-930s1c1
Sequence:CCGGCCGGTTTATTTATGTGCAATTCTCGAGAATTGCACATAAATAAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-489s1c1
Sequence:CCGGTCAGAGCATCAACAGCGCCTTCTCGAGAAGGCGCTGTTGATGCTCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-663s1c1
Sequence:CCGGGATCAAGAAGACCGACGTGAACTCGAGTTCACGTCGGTCTTCTTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-726s1c1
Sequence:CCGGCACAGTGAGCAGCAACGACAACTCGAGTTGTCGTTGCTGCTCACTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-276s1c1
Sequence:CCGGCTACTTCCATGGCTGGCTCATCTCGAGATGAGCCAGCCATGGAAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021973.2-1488s21c1
Sequence:CCGGGAGCTGAACGAAATCTTGAAACTCGAGTTTCAAGATTTCGTTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021973
HAND2 MISSION shRNA Lentiviral Transduction Particles
heart and neural crest derivatives expressed 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427446    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021973.2-2004s21c1
Sequence:CCGGTACTTGGCCTTTGGATATAAACTCGAGTTTATATCCAAAGGCCAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021973.1-930s1c1
Sequence:CCGGCCGGTTTATTTATGTGCAATTCTCGAGAATTGCACATAAATAAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-489s1c1
Sequence:CCGGTCAGAGCATCAACAGCGCCTTCTCGAGAAGGCGCTGTTGATGCTCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-663s1c1
Sequence:CCGGGATCAAGAAGACCGACGTGAACTCGAGTTCACGTCGGTCTTCTTGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-726s1c1
Sequence:CCGGCACAGTGAGCAGCAACGACAACTCGAGTTGTCGTTGCTGCTCACTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021973.1-276s1c1
Sequence:CCGGCTACTTCCATGGCTGGCTCATCTCGAGATGAGCCAGCCATGGAAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021973.2-1488s21c1
Sequence:CCGGGAGCTGAACGAAATCTTGAAACTCGAGTTTCAAGATTTCGTTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010402
HAND2 MISSION shRNA Bacterial Glycerol Stock
heart and neural crest derivatives expressed 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-1672s21c1
Sequence:CCGGAGTTGGATCATCCGGTTTATTCTCGAGAATAAACCGGATGATCCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-1979s21c1
Sequence:CCGGTACTCGGCCTTCGGATATAAACTCGAGTTTATATCCGAAGGCCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010402.4-1500s21c1
Sequence:CCGGAGTGAGCAGCAACGACAAGAACTCGAGTTCTTGTCGTTGCTGCTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010402.4-1436s21c1
Sequence:CCGGTCAAGAAGACCGACGTGAAAGCTCGAGCTTTCACGTCGGTCTTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-44s1c1
Sequence:CCGGGCACCATGAGGGCTACCCATTCTCGAGAATGGGTAGCCCTCATGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-126s1c1
Sequence:CCGGCCCTACTTCCACGGCTGGCTTCTCGAGAAGCCAGCCGTGGAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-334s1c1
Sequence:CCGGGCAGGACTCAGAGCATCAACACTCGAGTGTTGATGCTCTGAGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-440s1c1
Sequence:CCGGCAGATACATCGCCTACCTCATCTCGAGATGAGGTAGGCGATGTATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-398s1c1
Sequence:CCGGCGACACCAAACTCTCCAAGATCTCGAGATCTTGGAGAGTTTGGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-2052s21c1
Sequence:CCGGCATTTCTGTCGGGTCGGTTATCTCGAGATAACCGACCCGACAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010402
HAND2 MISSION shRNA shRNA Plasmid DNA
heart and neural crest derivatives expressed 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-1672s21c1
Sequence:CCGGAGTTGGATCATCCGGTTTATTCTCGAGAATAAACCGGATGATCCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-1979s21c1
Sequence:CCGGTACTCGGCCTTCGGATATAAACTCGAGTTTATATCCGAAGGCCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010402.4-1500s21c1
Sequence:CCGGAGTGAGCAGCAACGACAAGAACTCGAGTTCTTGTCGTTGCTGCTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010402.4-1436s21c1
Sequence:CCGGTCAAGAAGACCGACGTGAAAGCTCGAGCTTTCACGTCGGTCTTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-44s1c1
Sequence:CCGGGCACCATGAGGGCTACCCATTCTCGAGAATGGGTAGCCCTCATGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-126s1c1
Sequence:CCGGCCCTACTTCCACGGCTGGCTTCTCGAGAAGCCAGCCGTGGAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-334s1c1
Sequence:CCGGGCAGGACTCAGAGCATCAACACTCGAGTGTTGATGCTCTGAGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-440s1c1
Sequence:CCGGCAGATACATCGCCTACCTCATCTCGAGATGAGGTAGGCGATGTATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-398s1c1
Sequence:CCGGCGACACCAAACTCTCCAAGATCTCGAGATCTTGGAGAGTTTGGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-2052s21c1
Sequence:CCGGCATTTCTGTCGGGTCGGTTATCTCGAGATAACCGACCCGACAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010402
HAND2 MISSION shRNA Lentiviral Transduction Particles
heart and neural crest derivatives expressed 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426013    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-1672s21c1
Sequence:CCGGAGTTGGATCATCCGGTTTATTCTCGAGAATAAACCGGATGATCCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-1979s21c1
Sequence:CCGGTACTCGGCCTTCGGATATAAACTCGAGTTTATATCCGAAGGCCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010402.4-1500s21c1
Sequence:CCGGAGTGAGCAGCAACGACAAGAACTCGAGTTCTTGTCGTTGCTGCTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010402.4-1436s21c1
Sequence:CCGGTCAAGAAGACCGACGTGAAAGCTCGAGCTTTCACGTCGGTCTTCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-44s1c1
Sequence:CCGGGCACCATGAGGGCTACCCATTCTCGAGAATGGGTAGCCCTCATGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-126s1c1
Sequence:CCGGCCCTACTTCCACGGCTGGCTTCTCGAGAAGCCAGCCGTGGAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-334s1c1
Sequence:CCGGGCAGGACTCAGAGCATCAACACTCGAGTGTTGATGCTCTGAGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-440s1c1
Sequence:CCGGCAGATACATCGCCTACCTCATCTCGAGATGAGGTAGGCGATGTATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010402.2-398s1c1
Sequence:CCGGCGACACCAAACTCTCCAAGATCTCGAGATCTTGGAGAGTTTGGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010402.4-2052s21c1
Sequence:CCGGCATTTCTGTCGGGTCGGTTATCTCGAGATAACCGACCCGACAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)