EMAIL THIS PAGE TO A FRIEND

HAO1

hydroxyacid oxidase (glycolate oxidase) 1

70 Gene Product Result for
Synonyms: GOX GOX1 HAOX1
UniProtKB ID: Q9UJM8, Q14CQ0, Q9UPZ0, Q9Y3I7
Gene ID:
Human(54363) Summary: This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
Mouse(15112) hydroxyacid oxidase 1, liver
Rat(311446) hydroxyacid oxidase (glycolate oxidase) 1
Zebrafish(402827) hydroxyacid oxidase (glycolate oxidase) 1
cow(533957) hydroxyacid oxidase (glycolate oxidase) 1
Horse(100051628) hydroxyacid oxidase (glycolate oxidase) 1
chicken(416728) hydroxyacid oxidase (glycolate oxidase) 1
dog(485774) hydroxyacid oxidase (glycolate oxidase) 1
domestic cat(101089762) hydroxyacid oxidase (glycolate oxidase) 1
sheep(101118465) hydroxyacid oxidase (glycolate oxidase) 1
Domestic Rabbit(100342279) hydroxyacid oxidase (glycolate oxidase) 1
domestic guinea pig(100732140) hydroxyacid oxidase (glycolate oxidase) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017545 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017545 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017545 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003781 MISSION® esiRNA esiRNA targeting human HAO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017545 Rosetta Predictions human pricing
NM_001107780 Rosetta Predictions rat pricing
NM_010403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035496 predicted 1478
2 SASI_Hs01_00035497 predicted 700
3 SASI_Hs01_00035498 predicted 467
4 SASI_Hs01_00035500 predicted 709
5 SASI_Hs01_00035501 predicted 1414
6 SASI_Hs01_00035503 predicted 665
7 SASI_Hs01_00035504 predicted 653
8 SASI_Hs01_00035505 predicted 833
9 SASI_Hs02_00350175 predicted 199
10 SASI_Hs02_00350176 predicted 544
11 SASI_Hs01_00035499 predicted 643
12 SASI_Hs01_00035502 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232195 predicted 1164
2 SASI_Rn02_00232196 predicted 767
3 SASI_Rn02_00232197 predicted 316
4 SASI_Rn02_00232198 predicted 465
5 SASI_Rn02_00232199 predicted 904
6 SASI_Rn02_00232200 predicted 659
7 SASI_Rn02_00232201 predicted 849
8 SASI_Rn02_00232202 predicted 217
9 SASI_Rn02_00232203 predicted 1113
10 SASI_Rn02_00232204 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077021 predicted 545
2 SASI_Mm01_00077023 predicted 665
3 SASI_Mm01_00077024 predicted 768
4 SASI_Mm01_00077025 predicted 711
5 SASI_Mm02_00318532 predicted 320
6 SASI_Mm01_00077026 predicted 742
7 SASI_Mm01_00077027 predicted 455
8 SASI_Mm01_00077028 predicted 387
9 SASI_Mm02_00318533 predicted 696
10 SASI_Mm01_00077029 predicted 631
11 SASI_Mm01_00077022 predicted 542
12 SASI_Mm01_00077030 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017545
HAO1 MISSION shRNA Bacterial Glycerol Stock
hydroxyacid oxidase (glycolate oxidase) 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-124s1c1
Sequence:CCGGGAAGAAACTTTGGCTGATAATCTCGAGATTATCAGCCAAAGTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-1089s1c1
Sequence:CCGGCGACAAGACATTGGTGAGGAACTCGAGTTCCTCACCAATGTCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-408s1c1
Sequence:CCGGGCTGCAACTGTATATCTACAACTCGAGTTGTAGATATACAGTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-763s1c1
Sequence:CCGGGCTGTTAAACATGGCTTGAATCTCGAGATTCAAGCCATGTTTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-696s1c1
Sequence:CCGGGCTGAGAAGACTGACATCATTCTCGAGAATGATGTCAGTCTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017545.2-1552s21c1
Sequence:CCGGAGGTTCAAAGTGTTGGTAATGCTCGAGCATTACCAACACTTTGAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017545.2-230s21c1
Sequence:CCGGAGAGGGTCAGCATGCCAATATCTCGAGATATTGGCATGCTGACCCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017545.2-75s21c1
Sequence:CCGGAGTACTTCCAAAGTCTATATACTCGAGTATATAGACTTTGGAAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017545
HAO1 MISSION shRNA shRNA Plasmid DNA
hydroxyacid oxidase (glycolate oxidase) 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-124s1c1
Sequence:CCGGGAAGAAACTTTGGCTGATAATCTCGAGATTATCAGCCAAAGTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-1089s1c1
Sequence:CCGGCGACAAGACATTGGTGAGGAACTCGAGTTCCTCACCAATGTCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-408s1c1
Sequence:CCGGGCTGCAACTGTATATCTACAACTCGAGTTGTAGATATACAGTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-763s1c1
Sequence:CCGGGCTGTTAAACATGGCTTGAATCTCGAGATTCAAGCCATGTTTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-696s1c1
Sequence:CCGGGCTGAGAAGACTGACATCATTCTCGAGAATGATGTCAGTCTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017545.2-1552s21c1
Sequence:CCGGAGGTTCAAAGTGTTGGTAATGCTCGAGCATTACCAACACTTTGAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017545.2-230s21c1
Sequence:CCGGAGAGGGTCAGCATGCCAATATCTCGAGATATTGGCATGCTGACCCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017545.2-75s21c1
Sequence:CCGGAGTACTTCCAAAGTCTATATACTCGAGTATATAGACTTTGGAAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017545
HAO1 MISSION shRNA Lentiviral Transduction Particles
hydroxyacid oxidase (glycolate oxidase) 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-124s1c1
Sequence:CCGGGAAGAAACTTTGGCTGATAATCTCGAGATTATCAGCCAAAGTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-1089s1c1
Sequence:CCGGCGACAAGACATTGGTGAGGAACTCGAGTTCCTCACCAATGTCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-408s1c1
Sequence:CCGGGCTGCAACTGTATATCTACAACTCGAGTTGTAGATATACAGTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-763s1c1
Sequence:CCGGGCTGTTAAACATGGCTTGAATCTCGAGATTCAAGCCATGTTTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017545.2-696s1c1
Sequence:CCGGGCTGAGAAGACTGACATCATTCTCGAGAATGATGTCAGTCTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415627    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017545.2-1552s21c1
Sequence:CCGGAGGTTCAAAGTGTTGGTAATGCTCGAGCATTACCAACACTTTGAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017545.2-230s21c1
Sequence:CCGGAGAGGGTCAGCATGCCAATATCTCGAGATATTGGCATGCTGACCCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017545.2-75s21c1
Sequence:CCGGAGTACTTCCAAAGTCTATATACTCGAGTATATAGACTTTGGAAGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010403
HAO1 MISSION shRNA Bacterial Glycerol Stock
hydroxyacid oxidase (glycolate oxidase) 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-715s1c1
Sequence:CCGGCTATTGTTGTAAAGGGCATTTCTCGAGAAATGCCCTTTACAACAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010403.1-1579s1c1
Sequence:CCGGGCCCAGAGAAACATGAGGTTTCTCGAGAAACCTCATGTTTCTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-132s1c1
Sequence:CCGGGCTGATAACATCCAAGCATTTCTCGAGAAATGCTTGGATGTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-759s1c1
Sequence:CCGGGCTGTTAAACATGGTGTGGATCTCGAGATCCACACCATGTTTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-552s1c1
Sequence:CCGGCCACCACAACTCAGGATGAAACTCGAGTTTCATCCTGAGTTGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010403.2-1127s21c1
Sequence:CCGGGATCTGACAGTGCACAATATTCTCGAGAATATTGTGCACTGTCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010403.2-1439s21c1
Sequence:CCGGAGATATCCTCTGGTGAGATTGCTCGAGCAATCTCACCAGAGGATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010403.2-1484s21c1
Sequence:CCGGTACTGACCTCACTGTTCATTACTCGAGTAATGAACAGTGAGGTCAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010403
HAO1 MISSION shRNA shRNA Plasmid DNA
hydroxyacid oxidase (glycolate oxidase) 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-715s1c1
Sequence:CCGGCTATTGTTGTAAAGGGCATTTCTCGAGAAATGCCCTTTACAACAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010403.1-1579s1c1
Sequence:CCGGGCCCAGAGAAACATGAGGTTTCTCGAGAAACCTCATGTTTCTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-132s1c1
Sequence:CCGGGCTGATAACATCCAAGCATTTCTCGAGAAATGCTTGGATGTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-759s1c1
Sequence:CCGGGCTGTTAAACATGGTGTGGATCTCGAGATCCACACCATGTTTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-552s1c1
Sequence:CCGGCCACCACAACTCAGGATGAAACTCGAGTTTCATCCTGAGTTGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010403.2-1127s21c1
Sequence:CCGGGATCTGACAGTGCACAATATTCTCGAGAATATTGTGCACTGTCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010403.2-1439s21c1
Sequence:CCGGAGATATCCTCTGGTGAGATTGCTCGAGCAATCTCACCAGAGGATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010403.2-1484s21c1
Sequence:CCGGTACTGACCTCACTGTTCATTACTCGAGTAATGAACAGTGAGGTCAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010403
HAO1 MISSION shRNA Lentiviral Transduction Particles
hydroxyacid oxidase (glycolate oxidase) 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-715s1c1
Sequence:CCGGCTATTGTTGTAAAGGGCATTTCTCGAGAAATGCCCTTTACAACAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010403.1-1579s1c1
Sequence:CCGGGCCCAGAGAAACATGAGGTTTCTCGAGAAACCTCATGTTTCTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-132s1c1
Sequence:CCGGGCTGATAACATCCAAGCATTTCTCGAGAAATGCTTGGATGTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-759s1c1
Sequence:CCGGGCTGTTAAACATGGTGTGGATCTCGAGATCCACACCATGTTTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010403.1-552s1c1
Sequence:CCGGCCACCACAACTCAGGATGAAACTCGAGTTTCATCCTGAGTTGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010403.2-1127s21c1
Sequence:CCGGGATCTGACAGTGCACAATATTCTCGAGAATATTGTGCACTGTCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010403.2-1439s21c1
Sequence:CCGGAGATATCCTCTGGTGAGATTGCTCGAGCAATCTCACCAGAGGATATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010403.2-1484s21c1
Sequence:CCGGTACTGACCTCACTGTTCATTACTCGAGTAATGAACAGTGAGGTCAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)