EMAIL THIS PAGE TO A FRIEND

HAO2

hydroxyacid oxidase 2 (long chain)

63 Gene Product Result for
Synonyms: GIG16 HAOX2
UniProtKB ID: Q9NYQ3, Q2TU86, Q9UJS6
Gene ID:
Human(51179) Summary: This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed predominantly in liver and kidney and has the highest activity toward the substrate 2-hydroxypalmitate. Two alternatively spliced variants encoding the same isoform have been described. [provided by RefSeq, Jul 2008]
Mouse(56185) hydroxyacid oxidase 2
Rat(84029) hydroxyacid oxidase 2 (long chain)
naked mole-rat(101705559) hydroxyacid oxidase 2 (long chain)
sheep(101110803) hydroxyacid oxidase 2 (long chain)
Zebrafish(393455) hydroxyacid oxidase 2 (long chain)
cow(509481) hydroxyacid oxidase 2 (long chain)
domestic cat(101088259) hydroxyacid oxidase 2 (long chain)
dog(475814) hydroxyacid oxidase 2 (long chain)
chicken(418311) hydroxyacid oxidase 2 (long chain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016527 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092241 MISSION® esiRNA esiRNA human HAO2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005783 Rosetta Predictions human pricing
NM_016527 Rosetta Predictions human pricing
NM_032082 Rosetta Predictions rat pricing
NM_019545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115515 predicted 848
2 SASI_Hs01_00115516 predicted 865
3 SASI_Hs01_00115517 predicted 1041
4 SASI_Hs01_00115518 predicted 1417
5 SASI_Hs01_00115519 predicted 1054
6 SASI_Hs01_00115520 predicted 1327
7 SASI_Hs01_00115521 predicted 875
8 SASI_Hs01_00115522 predicted 1118
9 SASI_Hs01_00115524 predicted 781
10 SASI_Hs02_00305026 predicted 1102
11 SASI_Hs01_00115523 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080887 predicted 621
2 SASI_Hs01_00080888 predicted 639
3 SASI_Hs01_00080890 predicted 824
4 SASI_Hs01_00080891 predicted 1191
5 SASI_Hs01_00080892 predicted 832
6 SASI_Hs01_00080893 predicted 1102
7 SASI_Hs01_00080894 predicted 647
8 SASI_Hs01_00080895 predicted 895
9 SASI_Hs02_00349629 predicted 560
10 SASI_Hs02_00349630 predicted 881
11 SASI_Hs01_00080889 predicted 472
12 SASI_Hs01_00080896 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092545 predicted 1223
2 SASI_Rn01_00092546 predicted 852
3 SASI_Rn01_00092547 predicted 1130
4 SASI_Rn02_00265460 predicted 642
5 SASI_Rn01_00092551 predicted 727
6 SASI_Rn01_00092552 predicted 903
7 SASI_Rn02_00265461 predicted 973
8 SASI_Rn02_00265462 predicted 821
9 SASI_Rn01_00092553 predicted 1195
10 SASI_Rn01_00092554 predicted 1239
11 SASI_Rn01_00092548 predicted 528
12 SASI_Rn01_00092549 predicted 222
13 SASI_Rn01_00092550 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324588 predicted 1244
2 SASI_Mm01_00061199 predicted 821
3 SASI_Mm01_00061200 predicted 613
4 SASI_Mm01_00061201 predicted 1110
5 SASI_Mm01_00061202 predicted 1218
6 SASI_Mm01_00061203 predicted 946
7 SASI_Mm01_00061204 predicted 688
8 SASI_Mm01_00061205 predicted 942
9 SASI_Mm01_00061206 predicted 602
10 SASI_Mm01_00061208 predicted 1212
11 SASI_Mm01_00061207 predicted 828
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019545
HAO2 MISSION shRNA Bacterial Glycerol Stock
hydroxyacid oxidase 2 (long chain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-1260s1c1
Sequence:CCGGCCTGATTCAGTTCTCCAGATTCTCGAGAATCTGGAGAACTGAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019545.2-1319s1c1
Sequence:CCGGGCTTTCAACATAGTGTGTGATCTCGAGATCACACACTATGTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-942s1c1
Sequence:CCGGCCGAGGCATCATTGTTTCCAACTCGAGTTGGAAACAATGATGCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-880s1c1
Sequence:CCGGCCCATTATCCTCAAAGGGATTCTCGAGAATCCCTTTGAGGATAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-591s1c1
Sequence:CCGGCCTCCATTGGTTCCAACTTTACTCGAGTAAAGTTGGAACCAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019545
HAO2 MISSION shRNA shRNA Plasmid DNA
hydroxyacid oxidase 2 (long chain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-1260s1c1
Sequence:CCGGCCTGATTCAGTTCTCCAGATTCTCGAGAATCTGGAGAACTGAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019545.2-1319s1c1
Sequence:CCGGGCTTTCAACATAGTGTGTGATCTCGAGATCACACACTATGTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-942s1c1
Sequence:CCGGCCGAGGCATCATTGTTTCCAACTCGAGTTGGAAACAATGATGCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-880s1c1
Sequence:CCGGCCCATTATCCTCAAAGGGATTCTCGAGAATCCCTTTGAGGATAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-591s1c1
Sequence:CCGGCCTCCATTGGTTCCAACTTTACTCGAGTAAAGTTGGAACCAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019545
HAO2 MISSION shRNA Lentiviral Transduction Particles
hydroxyacid oxidase 2 (long chain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-1260s1c1
Sequence:CCGGCCTGATTCAGTTCTCCAGATTCTCGAGAATCTGGAGAACTGAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076618    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019545.2-1319s1c1
Sequence:CCGGGCTTTCAACATAGTGTGTGATCTCGAGATCACACACTATGTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-942s1c1
Sequence:CCGGCCGAGGCATCATTGTTTCCAACTCGAGTTGGAAACAATGATGCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-880s1c1
Sequence:CCGGCCCATTATCCTCAAAGGGATTCTCGAGAATCCCTTTGAGGATAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019545.2-591s1c1
Sequence:CCGGCCTCCATTGGTTCCAACTTTACTCGAGTAAAGTTGGAACCAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016527
HAO2 MISSION shRNA Bacterial Glycerol Stock
hydroxyacid oxidase 2 (long chain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016527.1-1243s1c1
Sequence:CCGGCCCATATTTCCCACATTTCTACTCGAGTAGAAATGTGGGAAATATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-1087s1c1
Sequence:CCGGCGCTGAGATCAATCGAAACTTCTCGAGAAGTTTCGATTGATCTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-945s1c1
Sequence:CCGGCCCTTGGAGCTAAGTGCATTTCTCGAGAAATGCACTTAGCTCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-478s1c1
Sequence:CCGGGCAGCTGAACAAACAGTTGATCTCGAGATCAACTGTTTGTTCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-787s1c1
Sequence:CCGGCCAGGGTATCATTGTTTCCAACTCGAGTTGGAAACAATGATACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016527
HAO2 MISSION shRNA shRNA Plasmid DNA
hydroxyacid oxidase 2 (long chain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016527.1-1243s1c1
Sequence:CCGGCCCATATTTCCCACATTTCTACTCGAGTAGAAATGTGGGAAATATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-1087s1c1
Sequence:CCGGCGCTGAGATCAATCGAAACTTCTCGAGAAGTTTCGATTGATCTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-945s1c1
Sequence:CCGGCCCTTGGAGCTAAGTGCATTTCTCGAGAAATGCACTTAGCTCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-478s1c1
Sequence:CCGGGCAGCTGAACAAACAGTTGATCTCGAGATCAACTGTTTGTTCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-787s1c1
Sequence:CCGGCCAGGGTATCATTGTTTCCAACTCGAGTTGGAAACAATGATACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016527
HAO2 MISSION shRNA Lentiviral Transduction Particles
hydroxyacid oxidase 2 (long chain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016527.1-1243s1c1
Sequence:CCGGCCCATATTTCCCACATTTCTACTCGAGTAGAAATGTGGGAAATATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-1087s1c1
Sequence:CCGGCGCTGAGATCAATCGAAACTTCTCGAGAAGTTTCGATTGATCTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-945s1c1
Sequence:CCGGCCCTTGGAGCTAAGTGCATTTCTCGAGAAATGCACTTAGCTCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-478s1c1
Sequence:CCGGGCAGCTGAACAAACAGTTGATCTCGAGATCAACTGTTTGTTCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016527.1-787s1c1
Sequence:CCGGCCAGGGTATCATTGTTTCCAACTCGAGTTGGAAACAATGATACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)