EMAIL THIS PAGE TO A FRIEND

HAP1

huntingtin-associated protein 1

144 Gene Product Result for
Synonyms: HAP2 HIP5 HLP hHLP1
Gene ID:
Human(9001) Summary: Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with huntingtin, with two cytoskeletal proteins (dynactin and pericentriolar autoantigen protein 1), and with a hepatocyte growth factor-regulated tyrosine kinase substrate. The interactions with cytoskeletal proteins and a kinase substrate suggest a role for this protein in vesicular trafficking or organelle transport. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(15114) huntingtin-associated protein 1
Rat(29430) huntingtin-associated protein 1
dog(607751) huntingtin-associated protein 1
cow(618422) huntingtin-associated protein 1
domestic cat(101088631) huntingtin-associated protein 1
sheep(101108406) huntingtin-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003949 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079870 Rosetta Predictions human pricing
NM_001079871 Rosetta Predictions human pricing
NM_003949 Rosetta Predictions human pricing
NM_177977 Rosetta Predictions human pricing
NM_024133 Rosetta Predictions rat pricing
NM_177982 Rosetta Predictions rat pricing
NM_010404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314000 predicted 1735
2 SASI_Hs02_00314001 predicted 1885
3 SASI_Hs02_00314002 predicted 1876
4 SASI_Hs02_00314003 predicted 1798
5 SASI_Hs02_00314004 predicted 1659
6 SASI_Hs02_00314005 predicted 1614
7 SASI_Hs02_00314006 predicted 1787
8 SASI_Hs02_00314007 predicted 258
9 SASI_Hs02_00314008 predicted 1959
10 SASI_Hs02_00314009 predicted 1715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314010 predicted 1702
2 SASI_Hs02_00314011 predicted 1863
3 SASI_Hs02_00314012 predicted 1849
4 SASI_Hs02_00314013 predicted 1777
5 SASI_Hs02_00314014 predicted 1629
6 SASI_Hs02_00314015 predicted 1590
7 SASI_Hs02_00314016 predicted 1762
8 SASI_Hs02_00314017 predicted 254
9 SASI_Hs02_00314018 predicted 1934
10 SASI_Hs02_00314019 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190197 predicted 1938
2 SASI_Hs01_00190198 predicted 2091
3 SASI_Hs01_00190200 predicted 2079
4 SASI_Hs01_00190201 predicted 2009
5 SASI_Hs02_00336613 predicted 1867
6 SASI_Hs01_00190203 predicted 1812
7 SASI_Hs01_00190204 predicted 1992
8 SASI_Hs01_00190205 predicted 256
9 SASI_Hs01_00190206 predicted 2166
10 SASI_Hs02_00336614 predicted 1920
11 SASI_Hs01_00190199 predicted 522
12 SASI_Hs01_00190202 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048480 predicted 1785
2 SASI_Hs01_00048481 predicted 1938
3 SASI_Hs01_00048483 predicted 1929
4 SASI_Hs01_00048484 predicted 1850
5 SASI_Hs02_00369452 predicted 1711
6 SASI_Hs01_00048486 predicted 1657
7 SASI_Hs01_00048487 predicted 1836
8 SASI_Hs01_00048488 predicted 254
9 SASI_Hs01_00048489 predicted 2009
10 SASI_Hs02_00369453 predicted 1766
11 SASI_Hs01_00048482 predicted 522
12 SASI_Hs01_00048485 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057811 predicted 249
2 SASI_Rn01_00057812 predicted 246
3 SASI_Rn01_00057813 predicted 1248
4 SASI_Rn01_00057814 predicted 1213
5 SASI_Rn01_00057816 predicted 245
6 SASI_Rn01_00057817 predicted 1467
7 SASI_Rn01_00057818 predicted 1212
8 SASI_Rn01_00057819 predicted 1264
9 SASI_Rn01_00057820 predicted 1326
10 SASI_Rn02_00263852 predicted 1232
11 SASI_Rn01_00057815 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084835 predicted 247
2 SASI_Rn01_00084836 predicted 243
3 SASI_Rn01_00084837 predicted 1248
4 SASI_Rn01_00084838 predicted 1213
5 SASI_Rn01_00084839 predicted 2264
6 SASI_Rn01_00084840 predicted 2254
7 SASI_Rn01_00084842 predicted 1469
8 SASI_Rn01_00084843 predicted 2262
9 SASI_Rn01_00084844 predicted 1271
10 SASI_Rn02_00269606 predicted 1322
11 SASI_Rn01_00084841 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025869 predicted 1839
2 SASI_Mm01_00025870 predicted 992
3 SASI_Mm01_00025871 predicted 1896
4 SASI_Mm01_00025872 predicted 439
5 SASI_Mm01_00025873 predicted 615
6 SASI_Mm01_00025874 predicted 1880
7 SASI_Mm01_00025875 predicted 1784
8 SASI_Mm01_00025877 predicted 1790
9 SASI_Mm02_00318534 predicted 1812
10 SASI_Mm01_00025878 predicted 533
11 SASI_Mm01_00025876 predicted 1307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003949
HAP1 MISSION shRNA Bacterial Glycerol Stock
huntingtin-associated protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-527s1c1
Sequence:CCGGGACGTCAAAGTGATGTTATATCTCGAGATATAACATCACTTTGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-1037s1c1
Sequence:CCGGGATGAGGAACAGATGCTCATTCTCGAGAATGAGCATCTGTTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-836s1c1
Sequence:CCGGGAAGAGGAACAGGAAGAAGAACTCGAGTTCTTCTTCCTGTTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003949.2-2096s1c1
Sequence:CCGGGCATGGACTTTGCATATCATTCTCGAGAATGATATGCAAAGTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-524s1c1
Sequence:CCGGGAAGACGTCAAAGTGATGTTACTCGAGTAACATCACTTTGACGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003949.2-3016s1c1
Sequence:CCGGGCAGGTTATAAACTGAACCATCTCGAGATGGTTCAGTTTATAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003949
HAP1 MISSION shRNA shRNA Plasmid DNA
huntingtin-associated protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-527s1c1
Sequence:CCGGGACGTCAAAGTGATGTTATATCTCGAGATATAACATCACTTTGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-1037s1c1
Sequence:CCGGGATGAGGAACAGATGCTCATTCTCGAGAATGAGCATCTGTTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-836s1c1
Sequence:CCGGGAAGAGGAACAGGAAGAAGAACTCGAGTTCTTCTTCCTGTTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003949.2-2096s1c1
Sequence:CCGGGCATGGACTTTGCATATCATTCTCGAGAATGATATGCAAAGTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-524s1c1
Sequence:CCGGGAAGACGTCAAAGTGATGTTACTCGAGTAACATCACTTTGACGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003949.2-3016s1c1
Sequence:CCGGGCAGGTTATAAACTGAACCATCTCGAGATGGTTCAGTTTATAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003949
HAP1 MISSION shRNA Lentiviral Transduction Particles
huntingtin-associated protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-527s1c1
Sequence:CCGGGACGTCAAAGTGATGTTATATCTCGAGATATAACATCACTTTGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-1037s1c1
Sequence:CCGGGATGAGGAACAGATGCTCATTCTCGAGAATGAGCATCTGTTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-836s1c1
Sequence:CCGGGAAGAGGAACAGGAAGAAGAACTCGAGTTCTTCTTCCTGTTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147714    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003949.2-2096s1c1
Sequence:CCGGGCATGGACTTTGCATATCATTCTCGAGAATGATATGCAAAGTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003949.2-524s1c1
Sequence:CCGGGAAGACGTCAAAGTGATGTTACTCGAGTAACATCACTTTGACGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003949.2-3016s1c1
Sequence:CCGGGCAGGTTATAAACTGAACCATCTCGAGATGGTTCAGTTTATAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177981
VALIDATED
HAP1 MISSION shRNA Bacterial Glycerol Stock
huntingtin-associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-2075s1c1
Sequence:CCGGCCCGTGTCTATGAGTTCTGAACTCGAGTTCAGAACTCATAGACACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177981.1-546s1c1
Sequence:CCGGAGGAGAATAATAAGCTGGAAACTCGAGTTTCCAGCTTATTATTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-1340s1c1
Sequence:CCGGCCTGCGTATTTCATGGAGAGACTCGAGTCTCTCCATGAAATACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-1654s1c1
Sequence:CCGGCCTGGACATGAAGTATGTCCTCTCGAGAGGACATACTTCATGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-419s1c1
Sequence:CCGGCCCACGAAGAAGATCACCGAACTCGAGTTCGGTGATCTTCTTCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177981
VALIDATED
HAP1 MISSION shRNA shRNA Plasmid DNA
huntingtin-associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-2075s1c1
Sequence:CCGGCCCGTGTCTATGAGTTCTGAACTCGAGTTCAGAACTCATAGACACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177981.1-546s1c1
Sequence:CCGGAGGAGAATAATAAGCTGGAAACTCGAGTTTCCAGCTTATTATTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-1340s1c1
Sequence:CCGGCCTGCGTATTTCATGGAGAGACTCGAGTCTCTCCATGAAATACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-1654s1c1
Sequence:CCGGCCTGGACATGAAGTATGTCCTCTCGAGAGGACATACTTCATGTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-419s1c1
Sequence:CCGGCCCACGAAGAAGATCACCGAACTCGAGTTCGGTGATCTTCTTCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177981
VALIDATED
HAP1 MISSION shRNA Lentiviral Transduction Particles
huntingtin-associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-2075s1c1
Sequence:CCGGCCCGTGTCTATGAGTTCTGAACTCGAGTTCAGAACTCATAGACACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177981.1-546s1c1
Sequence:CCGGAGGAGAATAATAAGCTGGAAACTCGAGTTTCCAGCTTATTATTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-1340s1c1
Sequence:CCGGCCTGCGTATTTCATGGAGAGACTCGAGTCTCTCCATGAAATACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-1654s1c1
Sequence:CCGGCCTGGACATGAAGTATGTCCTCTCGAGAGGACATACTTCATGTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177981.1-419s1c1
Sequence:CCGGCCCACGAAGAAGATCACCGAACTCGAGTTCGGTGATCTTCTTCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)