EMAIL THIS PAGE TO A FRIEND

HAPLN1

hyaluronan and proteoglycan link protein 1

80 Gene Product Result for
Synonyms: CRTL1
UniProtKB ID: P10915, B2R9A9
Gene ID:
Mouse(12950) hyaluronan and proteoglycan link protein 1
Rat(29331) hyaluronan and proteoglycan link protein 1
chicken(396475) hyaluronan and proteoglycan link protein 1
dog(488921) hyaluronan and proteoglycan link protein 1
Horse(100034208) hyaluronan and proteoglycan link protein 1
cow(281717) hyaluronan and proteoglycan link protein 1
domestic cat(101094398) hyaluronan and proteoglycan link protein 1
domestic guinea pig(100729224) hyaluronan and proteoglycan link protein 1
naked mole-rat(101711003) hyaluronan and proteoglycan link protein 1
sheep(101103643) hyaluronan and proteoglycan link protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001884 Rosetta Predictions human pricing
NM_019189 Rosetta Predictions rat pricing
NM_013500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168332 predicted 261
2 SASI_Hs02_00332737 predicted 950
3 SASI_Hs01_00168333 predicted 1009
4 SASI_Hs01_00168334 predicted 809
5 SASI_Hs01_00168335 predicted 246
6 SASI_Hs01_00168336 predicted 428
7 SASI_Hs01_00168337 predicted 506
8 SASI_Hs01_00168338 predicted 351
9 SASI_Hs02_00332738 predicted 319
10 SASI_Hs01_00168339 predicted 275
11 SASI_Hs01_00168340 predicted 504
12 SASI_Hs01_00168341 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049426 predicted 464
2 SASI_Rn02_00261998 predicted 933
3 SASI_Rn01_00049428 predicted 304
4 SASI_Rn01_00049430 predicted 442
5 SASI_Rn01_00049432 predicted 775
6 SASI_Rn02_00261999 predicted 570
7 SASI_Rn02_00262000 predicted 385
8 SASI_Rn02_00262001 predicted 483
9 SASI_Rn02_00262002 predicted 528
10 SASI_Rn02_00262003 predicted 200
11 SASI_Rn01_00049427 predicted 826
12 SASI_Rn01_00049429 predicted 843
13 SASI_Rn01_00049431 predicted 283
14 SASI_Rn01_00049433 predicted 240
15 SASI_Rn01_00049434 predicted 641
16 SASI_Rn01_00049435 predicted 271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195055 predicted 625
2 SASI_Mm01_00195056 predicted 696
3 SASI_Mm02_00322151 predicted 379
4 SASI_Mm01_00195057 predicted 575
5 SASI_Mm02_00322152 predicted 699
6 SASI_Mm01_00195058 predicted 537
7 SASI_Mm01_00195059 predicted 732
8 SASI_Mm01_00195062 predicted 1163
9 SASI_Mm01_00195063 predicted 503
10 SASI_Mm01_00195064 predicted 613
11 SASI_Mm01_00195060 predicted 230
12 SASI_Mm01_00195061 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001884
VALIDATED
HAPLN1 MISSION shRNA Bacterial Glycerol Stock
hyaluronan and proteoglycan link protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001884.2-441s1c1
Sequence:CCGGCCAGGGTAGAGTGTTTCTGAACTCGAGTTCAGAAACACTCTACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001884.2-1416s1c1
Sequence:CCGGGCCAAACTGTTTAAGCTGTATCTCGAGATACAGCTTAAACAGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001884.2-203s1c1
Sequence:CCGGCTATTCACATCCAAGCAGAAACTCGAGTTTCTGCTTGGATGTGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001884.2-1253s1c1
Sequence:CCGGGAACTCATGCAAGTTACCAAACTCGAGTTTGGTAACTTGCATGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001884.2-508s1c1
Sequence:CCGGCTGGAAGATTATGGGAGATATCTCGAGATATCTCCCATAATCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001884.2-360s1c1
Sequence:CCGGGACCAAGCTAACTTCGGATTACTCGAGTAATCCGAAGTTAGCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001884.2-281s1c1
Sequence:CCGGGCAATGTTACACTGCCATGTACTCGAGTACATGGCAGTGTAACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-386s21c1
Sequence:CCGGTGGATCATGACAGAGCTATTCCTCGAGGAATAGCTCTGTCATGATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-1015s21c1
Sequence:CCGGGGAGTCAGGAACTACGGATTTCTCGAGAAATCCGTAGTTCCTGACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-722s21c1
Sequence:CCGGGATATAAGTGTGAGGTGATTGCTCGAGCAATCACCTCACACTTATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-958s21c1
Sequence:CCGGGTGCAATATCCCATCACAAAGCTCGAGCTTTGTGATGGGATATTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001884
VALIDATED
HAPLN1 MISSION shRNA shRNA Plasmid DNA
hyaluronan and proteoglycan link protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001884.2-441s1c1
Sequence:CCGGCCAGGGTAGAGTGTTTCTGAACTCGAGTTCAGAAACACTCTACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001884.2-1416s1c1
Sequence:CCGGGCCAAACTGTTTAAGCTGTATCTCGAGATACAGCTTAAACAGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001884.2-203s1c1
Sequence:CCGGCTATTCACATCCAAGCAGAAACTCGAGTTTCTGCTTGGATGTGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001884.2-1253s1c1
Sequence:CCGGGAACTCATGCAAGTTACCAAACTCGAGTTTGGTAACTTGCATGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001884.2-508s1c1
Sequence:CCGGCTGGAAGATTATGGGAGATATCTCGAGATATCTCCCATAATCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001884.2-360s1c1
Sequence:CCGGGACCAAGCTAACTTCGGATTACTCGAGTAATCCGAAGTTAGCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001884.2-281s1c1
Sequence:CCGGGCAATGTTACACTGCCATGTACTCGAGTACATGGCAGTGTAACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-386s21c1
Sequence:CCGGTGGATCATGACAGAGCTATTCCTCGAGGAATAGCTCTGTCATGATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-1015s21c1
Sequence:CCGGGGAGTCAGGAACTACGGATTTCTCGAGAAATCCGTAGTTCCTGACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-722s21c1
Sequence:CCGGGATATAAGTGTGAGGTGATTGCTCGAGCAATCACCTCACACTTATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-958s21c1
Sequence:CCGGGTGCAATATCCCATCACAAAGCTCGAGCTTTGTGATGGGATATTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001884
VALIDATED
HAPLN1 MISSION shRNA Lentiviral Transduction Particles
hyaluronan and proteoglycan link protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001884.2-441s1c1
Sequence:CCGGCCAGGGTAGAGTGTTTCTGAACTCGAGTTCAGAAACACTCTACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001884.2-1416s1c1
Sequence:CCGGGCCAAACTGTTTAAGCTGTATCTCGAGATACAGCTTAAACAGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150327    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001884.2-203s1c1
Sequence:CCGGCTATTCACATCCAAGCAGAAACTCGAGTTTCTGCTTGGATGTGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001884.2-1253s1c1
Sequence:CCGGGAACTCATGCAAGTTACCAAACTCGAGTTTGGTAACTTGCATGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001884.2-508s1c1
Sequence:CCGGCTGGAAGATTATGGGAGATATCTCGAGATATCTCCCATAATCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001884.2-360s1c1
Sequence:CCGGGACCAAGCTAACTTCGGATTACTCGAGTAATCCGAAGTTAGCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001884.2-281s1c1
Sequence:CCGGGCAATGTTACACTGCCATGTACTCGAGTACATGGCAGTGTAACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-386s21c1
Sequence:CCGGTGGATCATGACAGAGCTATTCCTCGAGGAATAGCTCTGTCATGATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-1015s21c1
Sequence:CCGGGGAGTCAGGAACTACGGATTTCTCGAGAAATCCGTAGTTCCTGACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-722s21c1
Sequence:CCGGGATATAAGTGTGAGGTGATTGCTCGAGCAATCACCTCACACTTATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001884.3-958s21c1
Sequence:CCGGGTGCAATATCCCATCACAAAGCTCGAGCTTTGTGATGGGATATTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013500
HAPLN1 MISSION shRNA Bacterial Glycerol Stock
hyaluronan and proteoglycan link protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-377s21c1
Sequence:GTACCGGCCAGATCAAGACAGAGTTATTCTCGAGAATAACTCTGTCTTGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013500.4-1546s21c1
Sequence:CCGGTAAAGCTATCAGTCGATATATCTCGAGATATATCGACTGATAGCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-1242s21c1
Sequence:CCGGGCAGCGTCCGCTATCCTATTTCTCGAGAAATAGGATAGCGGACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-1166s21c1
Sequence:CCGGGCGAAAGTGGGCCAGATATTTCTCGAGAAATATCTGGCCCACTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-690s21c1
Sequence:CCGGATCTTACCCTGGAGGATTATGCTCGAGCATAATCCTCCAGGGTAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013500
HAPLN1 MISSION shRNA shRNA Plasmid DNA
hyaluronan and proteoglycan link protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-377s21c1
Sequence:GTACCGGCCAGATCAAGACAGAGTTATTCTCGAGAATAACTCTGTCTTGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013500.4-1546s21c1
Sequence:CCGGTAAAGCTATCAGTCGATATATCTCGAGATATATCGACTGATAGCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-1242s21c1
Sequence:CCGGGCAGCGTCCGCTATCCTATTTCTCGAGAAATAGGATAGCGGACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-1166s21c1
Sequence:CCGGGCGAAAGTGGGCCAGATATTTCTCGAGAAATATCTGGCCCACTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-690s21c1
Sequence:CCGGATCTTACCCTGGAGGATTATGCTCGAGCATAATCCTCCAGGGTAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013500
HAPLN1 MISSION shRNA Lentiviral Transduction Particles
hyaluronan and proteoglycan link protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-377s21c1
Sequence:GTACCGGCCAGATCAAGACAGAGTTATTCTCGAGAATAACTCTGTCTTGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013500.4-1546s21c1
Sequence:CCGGTAAAGCTATCAGTCGATATATCTCGAGATATATCGACTGATAGCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-1242s21c1
Sequence:CCGGGCAGCGTCCGCTATCCTATTTCTCGAGAAATAGGATAGCGGACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-1166s21c1
Sequence:CCGGGCGAAAGTGGGCCAGATATTTCTCGAGAAATATCTGGCCCACTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013500.4-690s21c1
Sequence:CCGGATCTTACCCTGGAGGATTATGCTCGAGCATAATCCTCCAGGGTAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)