EMAIL THIS PAGE TO A FRIEND

HAPLN3

hyaluronan and proteoglycan link protein 3

47 Gene Product Result for
Synonyms: EXLD1 HsT19883
UniProtKB ID: Q96S86, A8K7P0
Gene ID:
Human(145864) Summary: This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Mouse(67666) hyaluronan and proteoglycan link protein 3
Rat(308773) hyaluronan and proteoglycan link protein 3
domestic guinea pig(100731400) hyaluronan and proteoglycan link protein 3
naked mole-rat(101697258) hyaluronan and proteoglycan link protein 3
sheep(101102761) hyaluronan and proteoglycan link protein 3
Zebrafish(406374) hyaluronan and proteoglycan link protein 3
dog(609165) hyaluronan and proteoglycan link protein 3
domestic cat(101091626) hyaluronan and proteoglycan link protein 3
cow(515224) hyaluronan and proteoglycan link protein 3
chicken(415495) hyaluronan and proteoglycan link protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178232 Rosetta Predictions human pricing
NM_001008559 Rosetta Predictions rat pricing
NM_178255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097258 predicted 226
2 SASI_Hs01_00097259 predicted 886
3 SASI_Hs01_00097260 predicted 203
4 SASI_Hs01_00097261 predicted 549
5 SASI_Hs01_00097262 predicted 260
6 SASI_Hs01_00097263 predicted 549
7 SASI_Hs01_00097264 predicted 1632
8 SASI_Hs01_00097265 predicted 498
9 SASI_Hs01_00097266 predicted 1022
10 SASI_Hs01_00097267 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076225 predicted 823
2 SASI_Rn01_00076226 predicted 312
3 SASI_Rn02_00199238 predicted 409
4 SASI_Rn01_00076228 predicted 302
5 SASI_Rn01_00076229 predicted 635
6 SASI_Rn01_00076230 predicted 229
7 SASI_Rn01_00076231 predicted 405
8 SASI_Rn01_00076232 predicted 608
9 SASI_Rn01_00076234 predicted 789
10 SASI_Rn02_00199239 predicted 598
11 SASI_Rn01_00076227 predicted 596
12 SASI_Rn01_00076233 predicted 890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119537 predicted 921
2 SASI_Mm01_00119538 predicted 405
3 SASI_Mm01_00119539 predicted 420
4 SASI_Mm01_00119540 predicted 1120
5 SASI_Mm01_00119542 predicted 285
6 SASI_Mm02_00348668 predicted 738
7 SASI_Mm01_00119543 predicted 234
8 SASI_Mm01_00119544 predicted 504
9 SASI_Mm01_00119545 predicted 1131
10 SASI_Mm01_00119546 predicted 712
11 SASI_Mm01_00119541 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178232
VALIDATED
HAPLN3 MISSION shRNA Bacterial Glycerol Stock
hyaluronan and proteoglycan link protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-622s1c1
Sequence:CCGGGTGTGGTCTTTCCTTACCAGTCTCGAGACTGGTAAGGAAAGACCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-881s1c1
Sequence:CCGGCCTGCACCGCTATGATGTATTCTCGAGAATACATCATAGCGGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178232.2-656s1c1
Sequence:CCGGCTACCAGTTCAACTTCCACGACTCGAGTCGTGGAAGTTGAACTGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-382s1c1
Sequence:CCGGGTGTCAAATGGTGGAAGCTGTCTCGAGACAGCTTCCACCATTTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-184s1c1
Sequence:CCGGCCTTCTACAACGGCTTCTACTCTCGAGAGTAGAAGCCGTTGTAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178232.2-894s1c1
Sequence:CCGGGATGTATTCTGCTTCGCTACTCTCGAGAGTAGCGAAGCAGAATACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-243s1c1
Sequence:CCGGCATGGCAAAGACCTCCTTAATCTCGAGATTAAGGAGGTCTTTGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-557s21c1
Sequence:CCGGTTACCGCTGTGAGGTCATTGACTCGAGTCAATGACCTCACAGCGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-187s21c1
Sequence:CCGGTCTACAACGGCTTCTACTACTCTCGAGAGTAGTAGAAGCCGTTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178232.2-1236s21c1
Sequence:CCGGTTCCCTCACTGGCTGTGTATTCTCGAGAATACACAGCCAGTGAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-244s21c1
Sequence:CCGGATGGCAAAGACCTCCTTAATGCTCGAGCATTAAGGAGGTCTTTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-1100s21c1
Sequence:CCGGTGTGGTTCACCCGCATCCTAACTCGAGTTAGGATGCGGGTGAACCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178232
VALIDATED
HAPLN3 MISSION shRNA shRNA Plasmid DNA
hyaluronan and proteoglycan link protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-622s1c1
Sequence:CCGGGTGTGGTCTTTCCTTACCAGTCTCGAGACTGGTAAGGAAAGACCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-881s1c1
Sequence:CCGGCCTGCACCGCTATGATGTATTCTCGAGAATACATCATAGCGGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178232.2-656s1c1
Sequence:CCGGCTACCAGTTCAACTTCCACGACTCGAGTCGTGGAAGTTGAACTGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-382s1c1
Sequence:CCGGGTGTCAAATGGTGGAAGCTGTCTCGAGACAGCTTCCACCATTTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-184s1c1
Sequence:CCGGCCTTCTACAACGGCTTCTACTCTCGAGAGTAGAAGCCGTTGTAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178232.2-894s1c1
Sequence:CCGGGATGTATTCTGCTTCGCTACTCTCGAGAGTAGCGAAGCAGAATACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-243s1c1
Sequence:CCGGCATGGCAAAGACCTCCTTAATCTCGAGATTAAGGAGGTCTTTGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-557s21c1
Sequence:CCGGTTACCGCTGTGAGGTCATTGACTCGAGTCAATGACCTCACAGCGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-187s21c1
Sequence:CCGGTCTACAACGGCTTCTACTACTCTCGAGAGTAGTAGAAGCCGTTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178232.2-1236s21c1
Sequence:CCGGTTCCCTCACTGGCTGTGTATTCTCGAGAATACACAGCCAGTGAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-244s21c1
Sequence:CCGGATGGCAAAGACCTCCTTAATGCTCGAGCATTAAGGAGGTCTTTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-1100s21c1
Sequence:CCGGTGTGGTTCACCCGCATCCTAACTCGAGTTAGGATGCGGGTGAACCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178232
VALIDATED
HAPLN3 MISSION shRNA Lentiviral Transduction Particles
hyaluronan and proteoglycan link protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-622s1c1
Sequence:CCGGGTGTGGTCTTTCCTTACCAGTCTCGAGACTGGTAAGGAAAGACCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-881s1c1
Sequence:CCGGCCTGCACCGCTATGATGTATTCTCGAGAATACATCATAGCGGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178232.2-656s1c1
Sequence:CCGGCTACCAGTTCAACTTCCACGACTCGAGTCGTGGAAGTTGAACTGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164971    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-382s1c1
Sequence:CCGGGTGTCAAATGGTGGAAGCTGTCTCGAGACAGCTTCCACCATTTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-184s1c1
Sequence:CCGGCCTTCTACAACGGCTTCTACTCTCGAGAGTAGAAGCCGTTGTAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178232.2-894s1c1
Sequence:CCGGGATGTATTCTGCTTCGCTACTCTCGAGAGTAGCGAAGCAGAATACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178232.2-243s1c1
Sequence:CCGGCATGGCAAAGACCTCCTTAATCTCGAGATTAAGGAGGTCTTTGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-557s21c1
Sequence:CCGGTTACCGCTGTGAGGTCATTGACTCGAGTCAATGACCTCACAGCGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-187s21c1
Sequence:CCGGTCTACAACGGCTTCTACTACTCTCGAGAGTAGTAGAAGCCGTTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178232.2-1236s21c1
Sequence:CCGGTTCCCTCACTGGCTGTGTATTCTCGAGAATACACAGCCAGTGAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-244s21c1
Sequence:CCGGATGGCAAAGACCTCCTTAATGCTCGAGCATTAAGGAGGTCTTTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178232.2-1100s21c1
Sequence:CCGGTGTGGTTCACCCGCATCCTAACTCGAGTTAGGATGCGGGTGAACCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178255
HAPLN3 MISSION shRNA Bacterial Glycerol Stock
hyaluronan and proteoglycan link protein 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-296s1c1
Sequence:CCGGCCTATTCAATGGCGTGAAGTTCTCGAGAACTTCACGCCATTGAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-923s1c1
Sequence:CCGGCCTGCATCGTTATGATGTGTTCTCGAGAACACATCATAACGATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-930s1c1
Sequence:CCGGCGTTATGATGTGTTCTGCTTTCTCGAGAAAGCAGAACACATCATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-233s1c1
Sequence:CCGGCAATGGCTTCTACTATTCCAACTCGAGTTGGAATAGTAGAAGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178255
HAPLN3 MISSION shRNA shRNA Plasmid DNA
hyaluronan and proteoglycan link protein 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-296s1c1
Sequence:CCGGCCTATTCAATGGCGTGAAGTTCTCGAGAACTTCACGCCATTGAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-923s1c1
Sequence:CCGGCCTGCATCGTTATGATGTGTTCTCGAGAACACATCATAACGATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-930s1c1
Sequence:CCGGCGTTATGATGTGTTCTGCTTTCTCGAGAAAGCAGAACACATCATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-233s1c1
Sequence:CCGGCAATGGCTTCTACTATTCCAACTCGAGTTGGAATAGTAGAAGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178255
HAPLN3 MISSION shRNA Lentiviral Transduction Particles
hyaluronan and proteoglycan link protein 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-296s1c1
Sequence:CCGGCCTATTCAATGGCGTGAAGTTCTCGAGAACTTCACGCCATTGAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-923s1c1
Sequence:CCGGCCTGCATCGTTATGATGTGTTCTCGAGAACACATCATAACGATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-930s1c1
Sequence:CCGGCGTTATGATGTGTTCTGCTTTCTCGAGAAAGCAGAACACATCATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178255.3-233s1c1
Sequence:CCGGCAATGGCTTCTACTATTCCAACTCGAGTTGGAATAGTAGAAGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)