EMAIL THIS PAGE TO A FRIEND

HARBI1

harbinger transposase derived 1

67 Gene Product Result for
Synonyms: C11orf77
UniProtKB ID: Q96MB7, D3DQP9
Gene ID:
Mouse(241547) harbinger transposase derived 1
Rat(690164) harbinger transposase derived 1
Zebrafish(445279) harbinger transposase derived 1
domestic cat(101088876) harbinger transposase derived 1
cow(514442) harbinger transposase derived 1
Horse(100057237) harbinger transposase derived 1
dog(483633) harbinger transposase derived 1
chicken(423193) harbinger transposase derived 1
domestic guinea pig(100717726) harbinger transposase derived 1
naked mole-rat(101724328) harbinger transposase derived 1
sheep(101114808) harbinger transposase derived 1
Domestic Rabbit(100349980) harbinger transposase derived 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173811 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173811 Rosetta Predictions human pricing
NM_001113793 Rosetta Predictions rat pricing
NM_178724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047828 predicted 1114
2 SASI_Hs01_00047830 predicted 359
3 SASI_Hs01_00047832 predicted 1011
4 SASI_Hs02_00368669 predicted 1367
5 SASI_Hs01_00047833 predicted 1240
6 SASI_Hs02_00368670 predicted 1239
7 SASI_Hs02_00368671 predicted 1372
8 SASI_Hs01_00047835 predicted 783
9 SASI_Hs01_00047836 predicted 541
10 SASI_Hs01_00047837 predicted 1265
11 SASI_Hs01_00047829 predicted 1097
12 SASI_Hs01_00047831 predicted 568
13 SASI_Hs01_00047834 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113793 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252183 predicted 378
2 SASI_Rn02_00252184 predicted 291
3 SASI_Rn02_00252185 predicted 1159
4 SASI_Rn02_00252186 predicted 617
5 SASI_Rn02_00252187 predicted 941
6 SASI_Rn02_00252188 predicted 1145
7 SASI_Rn02_00252189 predicted 875
8 SASI_Rn02_00252190 predicted 644
9 SASI_Rn02_00252191 predicted 564
10 SASI_Rn02_00252192 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349243 predicted 622
2 SASI_Mm02_00349244 predicted 611
3 SASI_Mm02_00349245 predicted 1438
4 SASI_Mm02_00349246 predicted 537
5 SASI_Mm02_00349247 predicted 1449
6 SASI_Mm02_00349248 predicted 1110
7 SASI_Mm02_00349249 predicted 1188
8 SASI_Mm02_00349250 predicted 1162
9 SASI_Mm02_00349251 predicted 1532
10 SASI_Mm02_00349252 predicted 902
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173811
VALIDATED
HARBI1 MISSION shRNA Bacterial Glycerol Stock
harbinger transposase derived 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173811.2-350s1c1
Sequence:CCGGCTTGATGTCCATGTATGGGTTCTCGAGAACCCATACATGGACATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173811.2-540s1c1
Sequence:CCGGGCGTCTATGAGTCGTTGTGTTCTCGAGAACACAACGACTCATAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-528s21c1
Sequence:CCGGGGAATCAGTCAGGCGTCTATGCTCGAGCATAGACGCCTGACTGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-977s21c1
Sequence:CCGGTCCAGCAGAATATCGCTATAACTCGAGTTATAGCGATATTCTGCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-1245s21c1
Sequence:CCGGGACTTAGAGGCTGACCGTATTCTCGAGAATACGGTCAGCCTCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173811.2-431s21c1
Sequence:CCGGTCAGCGATCCAGGGCTATTAGCTCGAGCTAATAGCCCTGGATCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173811.2-1535s21c1
Sequence:CCGGTAGGTTGAGTACCACTAATTTCTCGAGAAATTAGTGGTACTCAACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173811
VALIDATED
HARBI1 MISSION shRNA shRNA Plasmid DNA
harbinger transposase derived 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173811.2-350s1c1
Sequence:CCGGCTTGATGTCCATGTATGGGTTCTCGAGAACCCATACATGGACATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173811.2-540s1c1
Sequence:CCGGGCGTCTATGAGTCGTTGTGTTCTCGAGAACACAACGACTCATAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-528s21c1
Sequence:CCGGGGAATCAGTCAGGCGTCTATGCTCGAGCATAGACGCCTGACTGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-977s21c1
Sequence:CCGGTCCAGCAGAATATCGCTATAACTCGAGTTATAGCGATATTCTGCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-1245s21c1
Sequence:CCGGGACTTAGAGGCTGACCGTATTCTCGAGAATACGGTCAGCCTCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173811.2-431s21c1
Sequence:CCGGTCAGCGATCCAGGGCTATTAGCTCGAGCTAATAGCCCTGGATCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173811.2-1535s21c1
Sequence:CCGGTAGGTTGAGTACCACTAATTTCTCGAGAAATTAGTGGTACTCAACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173811
VALIDATED
HARBI1 MISSION shRNA Lentiviral Transduction Particles
harbinger transposase derived 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173811.2-350s1c1
Sequence:CCGGCTTGATGTCCATGTATGGGTTCTCGAGAACCCATACATGGACATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173811.2-540s1c1
Sequence:CCGGGCGTCTATGAGTCGTTGTGTTCTCGAGAACACAACGACTCATAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-528s21c1
Sequence:CCGGGGAATCAGTCAGGCGTCTATGCTCGAGCATAGACGCCTGACTGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-977s21c1
Sequence:CCGGTCCAGCAGAATATCGCTATAACTCGAGTTATAGCGATATTCTGCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_173811.2-1245s21c1
Sequence:CCGGGACTTAGAGGCTGACCGTATTCTCGAGAATACGGTCAGCCTCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173811.2-431s21c1
Sequence:CCGGTCAGCGATCCAGGGCTATTAGCTCGAGCTAATAGCCCTGGATCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173811.2-1535s21c1
Sequence:CCGGTAGGTTGAGTACCACTAATTTCTCGAGAAATTAGTGGTACTCAACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178724
VALIDATED
HARBI1 MISSION shRNA Bacterial Glycerol Stock
harbinger transposase derived 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178724.2-1064s1c1
Sequence:CCGGGCGGTCTTCTTTAACCAGTCACTCGAGTGACTGGTTAAAGAAGACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178724.2-1101s1c1
Sequence:CCGGCCCAAAGATAGCTGGCTTCTTCTCGAGAAGAAGCCAGCTATCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178724.2-955s1c1
Sequence:CCGGGAAAGGGTCTGCATTCTCTAACTCGAGTTAGAGAATGCAGACCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178724.2-1449s1c1
Sequence:CCGGGCCTGGGTTCTTTCATTATTACTCGAGTAATAATGAAAGAACCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178724
VALIDATED
HARBI1 MISSION shRNA shRNA Plasmid DNA
harbinger transposase derived 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178724.2-1064s1c1
Sequence:CCGGGCGGTCTTCTTTAACCAGTCACTCGAGTGACTGGTTAAAGAAGACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178724.2-1101s1c1
Sequence:CCGGCCCAAAGATAGCTGGCTTCTTCTCGAGAAGAAGCCAGCTATCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178724.2-955s1c1
Sequence:CCGGGAAAGGGTCTGCATTCTCTAACTCGAGTTAGAGAATGCAGACCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178724.2-1449s1c1
Sequence:CCGGGCCTGGGTTCTTTCATTATTACTCGAGTAATAATGAAAGAACCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178724
VALIDATED
HARBI1 MISSION shRNA Lentiviral Transduction Particles
harbinger transposase derived 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178724.2-1064s1c1
Sequence:CCGGGCGGTCTTCTTTAACCAGTCACTCGAGTGACTGGTTAAAGAAGACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178724.2-1101s1c1
Sequence:CCGGCCCAAAGATAGCTGGCTTCTTCTCGAGAAGAAGCCAGCTATCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178724.2-955s1c1
Sequence:CCGGGAAAGGGTCTGCATTCTCTAACTCGAGTTAGAGAATGCAGACCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178724.2-1449s1c1
Sequence:CCGGGCCTGGGTTCTTTCATTATTACTCGAGTAATAATGAAAGAACCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)