EMAIL THIS PAGE TO A FRIEND

HARS2

histidyl-tRNA synthetase 2, mitochondrial

51 Gene Product Result for
Synonyms: HARSL HARSR HO3 PRLTS2
UniProtKB ID: P49590
Gene ID:
Human(23438) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is an enzyme belonging to the class II family of aminoacyl-tRNA synthetases. Functioning in the synthesis of histidyl-transfer RNA, the enzyme plays an accessory role in the regulation of protein biosynthesis. The gene is located in a head-to-head orientation with HARS on chromosome five, where the homologous genes likely share a bidirectional promoter. Mutations in this gene are associated with the pathogenesis of Perrault syndrome, which involves ovarian dysgenesis and sensorineural hearing loss. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
Mouse(70791) histidyl-tRNA synthetase 2, mitochondrial (putative)
Rat(307491) histidyl-tRNA synthetase 2, mitochondrial
chicken(768802) histidyl-tRNA synthetase 2, mitochondrial (putative)
domestic cat(101098429) histidyl-tRNA synthetase 2, mitochondrial
cow(615182) histidyl-tRNA synthetase 2, mitochondrial (putative)
dog(478035) histidyl-tRNA synthetase 2, mitochondrial (putative)
domestic guinea pig(100730771) histidyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101713772) histidyl-tRNA synthetase 2, mitochondrial
sheep(101121599) histidyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0871 AQUA Peptide ISFDLSLA[R] human, mouse pricing
AQ0867 AQUA Peptide DQGGELLSL[R] human, mouse, rat pricing
AQ0869 AQUA Peptide GLAPEVAD[R] human, mouse, rat pricing
AQ0868 AQUA Peptide YDLTVPFA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012208 Rosetta Predictions human pricing
NM_001014012 Rosetta Predictions rat pricing
NM_080636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226145 predicted 1043
2 SASI_Hs01_00226146 predicted 788
3 SASI_Hs01_00226147 predicted 652
4 SASI_Hs01_00226149 predicted 1559
5 SASI_Hs01_00226150 predicted 720
6 SASI_Hs01_00226151 predicted 1570
7 SASI_Hs01_00226152 predicted 408
8 SASI_Hs01_00226153 predicted 619
9 SASI_Hs01_00226154 predicted 855
10 SASI_Hs02_00343870 predicted 712
11 SASI_Hs01_00226148 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051514 predicted 667
2 SASI_Rn01_00051515 predicted 754
3 SASI_Rn01_00051516 predicted 619
4 SASI_Rn01_00051517 predicted 550
5 SASI_Rn01_00051518 predicted 742
6 SASI_Rn01_00051519 predicted 264
7 SASI_Rn01_00051520 predicted 853
8 SASI_Rn01_00051521 predicted 206
9 SASI_Rn01_00051522 predicted 381
10 SASI_Rn01_00051523 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099038 predicted 689
2 SASI_Mm01_00099039 predicted 474
3 SASI_Mm01_00099040 predicted 693
4 SASI_Mm01_00099041 predicted 516
5 SASI_Mm01_00099042 predicted 1038
6 SASI_Mm02_00338184 predicted 1447
7 SASI_Mm01_00099043 predicted 1482
8 SASI_Mm01_00099044 predicted 433
9 SASI_Mm01_00099045 predicted 673
10 SASI_Mm01_00099046 predicted 1494
11 SASI_Mm01_00099047 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012208
VALIDATED
HARS2 MISSION shRNA Bacterial Glycerol Stock
histidyl-tRNA synthetase 2, mitochondrial
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012208.2-358s1c1
Sequence:CCGGGCACATCAAGAGAAACCAAATCTCGAGATTTGGTTTCTCTTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-1606s1c1
Sequence:CCGGGTGGTCATTATTGGTGAGCAACTCGAGTTGCTCACCAATAATGACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012208.2-625s1c1
Sequence:CCGGGCTCGTTATCTGGCCATGAATCTCGAGATTCATGGCCAGATAACGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-1131s1c1
Sequence:CCGGGCTATTTGAATACCTGACTTTCTCGAGAAAGTCAGGTATTCAAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-952s1c1
Sequence:CCGGGCTTGGAAAGATGTGAGACATCTCGAGATGTCTCACATCTTTCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012208.2-358s21c1
Sequence:CCGGGCACATCAAGAGAAACCAAATCTCGAGATTTGGTTTCTCTTGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1208s21c1
Sequence:CCGGACTATACAGGAGTGATCTATGCTCGAGCATAGATCACTCCTGTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1563s21c1
Sequence:CCGGATTAACCCAGCTGCACTATTGCTCGAGCAATAGTGCAGCTGGGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-704s21c1
Sequence:CCGGCCATAGTCCAAGGCCGTTATACTCGAGTATAACGGCCTTGGACTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1970s21c1
Sequence:CCGGTCTAGCTGCAGAGGCAAATTTCTCGAGAAATTTGCCTCTGCAGCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1595s21c1
Sequence:CCGGGCATTCCACTGGTGGTCATTACTCGAGTAATGACCACCAGTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012208
VALIDATED
HARS2 MISSION shRNA shRNA Plasmid DNA
histidyl-tRNA synthetase 2, mitochondrial
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012208.2-358s1c1
Sequence:CCGGGCACATCAAGAGAAACCAAATCTCGAGATTTGGTTTCTCTTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-1606s1c1
Sequence:CCGGGTGGTCATTATTGGTGAGCAACTCGAGTTGCTCACCAATAATGACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012208.2-625s1c1
Sequence:CCGGGCTCGTTATCTGGCCATGAATCTCGAGATTCATGGCCAGATAACGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-1131s1c1
Sequence:CCGGGCTATTTGAATACCTGACTTTCTCGAGAAAGTCAGGTATTCAAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-952s1c1
Sequence:CCGGGCTTGGAAAGATGTGAGACATCTCGAGATGTCTCACATCTTTCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012208.2-358s21c1
Sequence:CCGGGCACATCAAGAGAAACCAAATCTCGAGATTTGGTTTCTCTTGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1208s21c1
Sequence:CCGGACTATACAGGAGTGATCTATGCTCGAGCATAGATCACTCCTGTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1563s21c1
Sequence:CCGGATTAACCCAGCTGCACTATTGCTCGAGCAATAGTGCAGCTGGGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-704s21c1
Sequence:CCGGCCATAGTCCAAGGCCGTTATACTCGAGTATAACGGCCTTGGACTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1970s21c1
Sequence:CCGGTCTAGCTGCAGAGGCAAATTTCTCGAGAAATTTGCCTCTGCAGCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1595s21c1
Sequence:CCGGGCATTCCACTGGTGGTCATTACTCGAGTAATGACCACCAGTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012208
VALIDATED
HARS2 MISSION shRNA Lentiviral Transduction Particles
histidyl-tRNA synthetase 2, mitochondrial
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012208.2-358s1c1
Sequence:CCGGGCACATCAAGAGAAACCAAATCTCGAGATTTGGTTTCTCTTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-1606s1c1
Sequence:CCGGGTGGTCATTATTGGTGAGCAACTCGAGTTGCTCACCAATAATGACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012208.2-625s1c1
Sequence:CCGGGCTCGTTATCTGGCCATGAATCTCGAGATTCATGGCCAGATAACGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-1131s1c1
Sequence:CCGGGCTATTTGAATACCTGACTTTCTCGAGAAAGTCAGGTATTCAAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012208.2-952s1c1
Sequence:CCGGGCTTGGAAAGATGTGAGACATCTCGAGATGTCTCACATCTTTCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012208.2-358s21c1
Sequence:CCGGGCACATCAAGAGAAACCAAATCTCGAGATTTGGTTTCTCTTGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1208s21c1
Sequence:CCGGACTATACAGGAGTGATCTATGCTCGAGCATAGATCACTCCTGTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1563s21c1
Sequence:CCGGATTAACCCAGCTGCACTATTGCTCGAGCAATAGTGCAGCTGGGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-704s21c1
Sequence:CCGGCCATAGTCCAAGGCCGTTATACTCGAGTATAACGGCCTTGGACTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1970s21c1
Sequence:CCGGTCTAGCTGCAGAGGCAAATTTCTCGAGAAATTTGCCTCTGCAGCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_012208.2-1595s21c1
Sequence:CCGGGCATTCCACTGGTGGTCATTACTCGAGTAATGACCACCAGTGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080636
VALIDATED
HARS2 MISSION shRNA Bacterial Glycerol Stock
histidyl-tRNA synthetase 2, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080636.1-2381s1c1
Sequence:CCGGCCTGAGTTCATTTCCTAGCAACTCGAGTTGCTAGGAAATGAACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-425s1c1
Sequence:CCGGCGAGAAGTATGAAGACAACTTCTCGAGAAGTTGTCTTCATACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-446s1c1
Sequence:CCGGCGGCCTCATGTATGATTTGAACTCGAGTTCAAATCATACATGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-754s21c1
Sequence:CCGGGTCGGGTTGTAGATGGGATATCTCGAGATATCCCATCTACAACCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1563s21c1
Sequence:CCGGAGAGAAGAAGTGACCATTAATCTCGAGATTAATGGTCACTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1029s21c1
Sequence:CCGGTTTGAATACCTGAGGTTATTTCTCGAGAAATAACCTCAGGTATTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-754s1c2
Sequence:CCGGGTCGGGTTGTAGATGGGATATCTCGAGATATCCCATCTACAACCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-254s1c2
Sequence:CCGGCCATCAAGAGAAGCCGAATTTCTCGAGAAATTCGGCTTCTCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1683s21c1
Sequence:CCGGACCGAGTTCTGGTGGACTTTGCTCGAGCAAAGTCCACCAGAACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1489s21c1
Sequence:CCGGACATTCCTCTGATGGTCATTACTCGAGTAATGACCATCAGAGGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080636
VALIDATED
HARS2 MISSION shRNA shRNA Plasmid DNA
histidyl-tRNA synthetase 2, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080636.1-2381s1c1
Sequence:CCGGCCTGAGTTCATTTCCTAGCAACTCGAGTTGCTAGGAAATGAACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-425s1c1
Sequence:CCGGCGAGAAGTATGAAGACAACTTCTCGAGAAGTTGTCTTCATACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-446s1c1
Sequence:CCGGCGGCCTCATGTATGATTTGAACTCGAGTTCAAATCATACATGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-754s21c1
Sequence:CCGGGTCGGGTTGTAGATGGGATATCTCGAGATATCCCATCTACAACCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1563s21c1
Sequence:CCGGAGAGAAGAAGTGACCATTAATCTCGAGATTAATGGTCACTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1029s21c1
Sequence:CCGGTTTGAATACCTGAGGTTATTTCTCGAGAAATAACCTCAGGTATTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-754s1c2
Sequence:CCGGGTCGGGTTGTAGATGGGATATCTCGAGATATCCCATCTACAACCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-254s1c2
Sequence:CCGGCCATCAAGAGAAGCCGAATTTCTCGAGAAATTCGGCTTCTCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1683s21c1
Sequence:CCGGACCGAGTTCTGGTGGACTTTGCTCGAGCAAAGTCCACCAGAACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1489s21c1
Sequence:CCGGACATTCCTCTGATGGTCATTACTCGAGTAATGACCATCAGAGGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080636
VALIDATED
HARS2 MISSION shRNA Lentiviral Transduction Particles
histidyl-tRNA synthetase 2, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080636.1-2381s1c1
Sequence:CCGGCCTGAGTTCATTTCCTAGCAACTCGAGTTGCTAGGAAATGAACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-425s1c1
Sequence:CCGGCGAGAAGTATGAAGACAACTTCTCGAGAAGTTGTCTTCATACTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-446s1c1
Sequence:CCGGCGGCCTCATGTATGATTTGAACTCGAGTTCAAATCATACATGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-754s21c1
Sequence:CCGGGTCGGGTTGTAGATGGGATATCTCGAGATATCCCATCTACAACCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1563s21c1
Sequence:CCGGAGAGAAGAAGTGACCATTAATCTCGAGATTAATGGTCACTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1029s21c1
Sequence:CCGGTTTGAATACCTGAGGTTATTTCTCGAGAAATAACCTCAGGTATTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-754s1c2
Sequence:CCGGGTCGGGTTGTAGATGGGATATCTCGAGATATCCCATCTACAACCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080636.1-254s1c2
Sequence:CCGGCCATCAAGAGAAGCCGAATTTCTCGAGAAATTCGGCTTCTCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1683s21c1
Sequence:CCGGACCGAGTTCTGGTGGACTTTGCTCGAGCAAAGTCCACCAGAACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080636.1-1489s21c1
Sequence:CCGGACATTCCTCTGATGGTCATTACTCGAGTAATGACCATCAGAGGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)