EMAIL THIS PAGE TO A FRIEND

HARS

histidyl-tRNA synthetase

87 Gene Product Result for
Synonyms: HRS USH3B
UniProtKB ID: P12081, B4DHQ1, B4DY73, D6REN6, J3KNE5
Gene ID:
Human(3035) Summary: Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a cytoplasmic enzyme which belongs to the class II family of aminoacyl-tRNA synthetases. The enzyme is responsible for the synthesis of histidyl-transfer RNA, which is essential for the incorporation of histidine into proteins. The gene is located in a head-to-head orientation with HARSL on chromosome five, where the homologous genes share a bidirectional promoter. The gene product is a frequent target of autoantibodies in the human autoimmune disease polymyositis/dermatomyositis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(15115) histidyl-tRNA synthetase
Rat(307492) histidyl-tRNA synthetase
sheep(101120491) histidyl-tRNA synthetase
Domestic Rabbit(100351394) histidyl-tRNA synthetase
domestic guinea pig(100729679) histidyl-tRNA synthetase
naked mole-rat(101712452) histidyl-tRNA synthetase
Zebrafish(447847) histidyl-tRNA synthetase
chicken(416132) histidyl-tRNA synthetase
cow(510937) histidyl-tRNA synthetase
domestic cat(101097371) histidyl-tRNA synthetase
dog(478034) histidyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002109 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002109 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002109 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002109 Rosetta Predictions human pricing
NM_001025414 Rosetta Predictions rat pricing
NM_008214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183896 predicted 937
2 SASI_Hs01_00183897 predicted 582
3 SASI_Hs01_00183898 predicted 489
4 SASI_Hs01_00183899 predicted 1001
5 SASI_Hs01_00183900 predicted 1412
6 SASI_Hs01_00183901 predicted 711
7 SASI_Hs01_00183902 predicted 720
8 SASI_Hs01_00183903 predicted 1649
9 SASI_Hs01_00183904 predicted 1346
10 SASI_Hs02_00333225 predicted 1674
11 SASI_Hs01_00183895 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071378 predicted 866
2 SASI_Rn01_00071379 predicted 1157
3 SASI_Rn01_00071380 predicted 332
4 SASI_Rn01_00071381 predicted 285
5 SASI_Rn01_00071383 predicted 435
6 SASI_Rn01_00071384 predicted 1353
7 SASI_Rn01_00071385 predicted 290
8 SASI_Rn02_00203150 predicted 1176
9 SASI_Rn01_00071386 predicted 946
10 SASI_Rn01_00071387 predicted 915
11 SASI_Rn01_00071382 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082025 predicted 286
2 SASI_Mm01_00082026 predicted 1198
3 SASI_Mm01_00082027 predicted 300
4 SASI_Mm01_00082028 predicted 853
5 SASI_Mm01_00082029 predicted 435
6 SASI_Mm01_00082030 predicted 1159
7 SASI_Mm01_00082031 predicted 659
8 SASI_Mm01_00082032 predicted 1193
9 SASI_Mm01_00082033 predicted 1405
10 SASI_Mm01_00082034 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008214
VALIDATED
HARS MISSION shRNA Bacterial Glycerol Stock
histidyl-tRNA synthetase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.4-527s21c1
Sequence:CCGGTGAATAAACTGACCAACATTACTCGAGTAATGTTGGTCAGTTTATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008214.3-303s21c1
Sequence:CCGGCCTGTGTTTGAACTAAAGGAACTCGAGTTCCTTTAGTTCAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-252s21c1
Sequence:CCGGGATGTCATCATCCGCTGTTTCCTCGAGGAAACAGCGGATGATGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-929s21c1
Sequence:CCGGGCTGCTCTTTGAGTATCTAATCTCGAGATTAGATACTCAAAGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-1355s21c1
Sequence:CCGGCCCGAAGTTACTAAACCAGTTCTCGAGAACTGGTTTAGTAACTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-1613s21c1
Sequence:CCGGGTACTTAAACAGTCTGCATATCTCGAGATATGCAGACTGTTTAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-1614s1c1
Sequence:CCGGGTACTTAAACAGTCTGCATATCTCGAGATATGCAGACTGTTTAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-1356s1c1
Sequence:CCGGCCCGAAGTTACTAAACCAGTTCTCGAGAACTGGTTTAGTAACTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-304s1c1
Sequence:CCGGCCTGTGTTTGAACTAAAGGAACTCGAGTTCCTTTAGTTCAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-664s1c1
Sequence:CCGGCGCATCCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-455s1c1
Sequence:CCGGCCAACATTAAACGCTACCATACTCGAGTATGGTAGCGTTTAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008214
VALIDATED
HARS MISSION shRNA shRNA Plasmid DNA
histidyl-tRNA synthetase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.4-527s21c1
Sequence:CCGGTGAATAAACTGACCAACATTACTCGAGTAATGTTGGTCAGTTTATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008214.3-303s21c1
Sequence:CCGGCCTGTGTTTGAACTAAAGGAACTCGAGTTCCTTTAGTTCAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-252s21c1
Sequence:CCGGGATGTCATCATCCGCTGTTTCCTCGAGGAAACAGCGGATGATGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-929s21c1
Sequence:CCGGGCTGCTCTTTGAGTATCTAATCTCGAGATTAGATACTCAAAGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-1355s21c1
Sequence:CCGGCCCGAAGTTACTAAACCAGTTCTCGAGAACTGGTTTAGTAACTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-1613s21c1
Sequence:CCGGGTACTTAAACAGTCTGCATATCTCGAGATATGCAGACTGTTTAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-1614s1c1
Sequence:CCGGGTACTTAAACAGTCTGCATATCTCGAGATATGCAGACTGTTTAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-1356s1c1
Sequence:CCGGCCCGAAGTTACTAAACCAGTTCTCGAGAACTGGTTTAGTAACTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-304s1c1
Sequence:CCGGCCTGTGTTTGAACTAAAGGAACTCGAGTTCCTTTAGTTCAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-664s1c1
Sequence:CCGGCGCATCCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-455s1c1
Sequence:CCGGCCAACATTAAACGCTACCATACTCGAGTATGGTAGCGTTTAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008214
VALIDATED
HARS MISSION shRNA Lentiviral Transduction Particles
histidyl-tRNA synthetase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.4-527s21c1
Sequence:CCGGTGAATAAACTGACCAACATTACTCGAGTAATGTTGGTCAGTTTATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008214.3-303s21c1
Sequence:CCGGCCTGTGTTTGAACTAAAGGAACTCGAGTTCCTTTAGTTCAAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-252s21c1
Sequence:CCGGGATGTCATCATCCGCTGTTTCCTCGAGGAAACAGCGGATGATGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-929s21c1
Sequence:CCGGGCTGCTCTTTGAGTATCTAATCTCGAGATTAGATACTCAAAGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-1355s21c1
Sequence:CCGGCCCGAAGTTACTAAACCAGTTCTCGAGAACTGGTTTAGTAACTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008214.3-1613s21c1
Sequence:CCGGGTACTTAAACAGTCTGCATATCTCGAGATATGCAGACTGTTTAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-1614s1c1
Sequence:CCGGGTACTTAAACAGTCTGCATATCTCGAGATATGCAGACTGTTTAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-1356s1c1
Sequence:CCGGCCCGAAGTTACTAAACCAGTTCTCGAGAACTGGTTTAGTAACTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-304s1c1
Sequence:CCGGCCTGTGTTTGAACTAAAGGAACTCGAGTTCCTTTAGTTCAAACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-664s1c1
Sequence:CCGGCGCATCCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008214.2-455s1c1
Sequence:CCGGCCAACATTAAACGCTACCATACTCGAGTATGGTAGCGTTTAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002109
VALIDATED
HARS MISSION shRNA Bacterial Glycerol Stock
histidyl-tRNA synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-725s21c1
Sequence:CCGGCGCATTCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-301s21c1
Sequence:CCGGCGAGAAGGTGTTTGACGTAATCTCGAGATTACGTCAAACACCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002109.3-1637s21c1
Sequence:CCGGGAAGTGGGACTGGCACTATTTCTCGAGAAATAGTGCCAGTCCCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-999s21c1
Sequence:CCGGTTGAGTACCTGACCCTATTTGCTCGAGCAAATAGGGTCAGGTACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-352s21c1
Sequence:CCGGAGTCATTGATACACCTGTATTCTCGAGAATACAGGTGTATCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002109.3-488s1c1
Sequence:CCGGGCTCGGTATTTGGCAATGAATCTCGAGATTCATTGCCAAATACCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002109.3-528s1c1
Sequence:CCGGGCTACCACATAGCAAAGGTATCTCGAGATACCTTTGCTATGTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-301s1c1
Sequence:CCGGCGAGAAGGTGTTTGACGTAATCTCGAGATTACGTCAAACACCTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-725s1c1
Sequence:CCGGCGCATTCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-1402s1c1
Sequence:CCGGGCTGTACAAGAAGAACCCAAACTCGAGTTTGGGTTCTTCTTGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002109
VALIDATED
HARS MISSION shRNA shRNA Plasmid DNA
histidyl-tRNA synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-725s21c1
Sequence:CCGGCGCATTCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-301s21c1
Sequence:CCGGCGAGAAGGTGTTTGACGTAATCTCGAGATTACGTCAAACACCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002109.3-1637s21c1
Sequence:CCGGGAAGTGGGACTGGCACTATTTCTCGAGAAATAGTGCCAGTCCCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-999s21c1
Sequence:CCGGTTGAGTACCTGACCCTATTTGCTCGAGCAAATAGGGTCAGGTACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-352s21c1
Sequence:CCGGAGTCATTGATACACCTGTATTCTCGAGAATACAGGTGTATCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002109.3-488s1c1
Sequence:CCGGGCTCGGTATTTGGCAATGAATCTCGAGATTCATTGCCAAATACCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002109.3-528s1c1
Sequence:CCGGGCTACCACATAGCAAAGGTATCTCGAGATACCTTTGCTATGTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-301s1c1
Sequence:CCGGCGAGAAGGTGTTTGACGTAATCTCGAGATTACGTCAAACACCTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-725s1c1
Sequence:CCGGCGCATTCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-1402s1c1
Sequence:CCGGGCTGTACAAGAAGAACCCAAACTCGAGTTTGGGTTCTTCTTGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002109
VALIDATED
HARS MISSION shRNA Lentiviral Transduction Particles
histidyl-tRNA synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-725s21c1
Sequence:CCGGCGCATTCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-301s21c1
Sequence:CCGGCGAGAAGGTGTTTGACGTAATCTCGAGATTACGTCAAACACCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002109.3-1637s21c1
Sequence:CCGGGAAGTGGGACTGGCACTATTTCTCGAGAAATAGTGCCAGTCCCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-999s21c1
Sequence:CCGGTTGAGTACCTGACCCTATTTGCTCGAGCAAATAGGGTCAGGTACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002109.3-352s21c1
Sequence:CCGGAGTCATTGATACACCTGTATTCTCGAGAATACAGGTGTATCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002109.3-488s1c1
Sequence:CCGGGCTCGGTATTTGGCAATGAATCTCGAGATTCATTGCCAAATACCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002109.3-528s1c1
Sequence:CCGGGCTACCACATAGCAAAGGTATCTCGAGATACCTTTGCTATGTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-301s1c1
Sequence:CCGGCGAGAAGGTGTTTGACGTAATCTCGAGATTACGTCAAACACCTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-725s1c1
Sequence:CCGGCGCATTCTAGATGGGATGTTTCTCGAGAAACATCCCATCTAGAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_002109.3-1402s1c1
Sequence:CCGGGCTGTACAAGAAGAACCCAAACTCGAGTTTGGGTTCTTCTTGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)