EMAIL THIS PAGE TO A FRIEND

HAS1

hyaluronan synthase 1

70 Gene Product Result for
Synonyms: HAS
UniProtKB ID: Q92839, Q14470, Q9NS49
Gene ID:
Human(3036) Summary: Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. [provided by RefSeq, Jul 2008]
Mouse(15116) hyaluronan synthase1
Rat(282821) hyaluronan synthase 1
domestic guinea pig(100712902) hyaluronan synthase 1
naked mole-rat(101707808) hyaluronan synthase 1
Zebrafish(403130) hyaluronan synthase 1
cow(282820) hyaluronan synthase 1
domestic cat(101093224) hyaluronan synthase 1
dog(611700) hyaluronan synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001523 Rosetta Predictions human pricing
NM_172323 Rosetta Predictions rat pricing
NM_008215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124626 predicted 947
2 SASI_Hs01_00124627 predicted 1276
3 SASI_Hs02_00332054 predicted 979
4 SASI_Hs01_00124628 predicted 970
5 SASI_Hs01_00124629 predicted 1154
6 SASI_Hs01_00124630 predicted 1016
7 SASI_Hs01_00124631 predicted 962
8 SASI_Hs01_00124632 predicted 1447
9 SASI_Hs01_00124633 predicted 1166
10 SASI_Hs02_00332055 predicted 1399
11 SASI_Hs01_00124634 predicted 1407
12 SASI_Hs01_00124635 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089854 predicted 1786
2 SASI_Rn01_00089855 predicted 1089
3 SASI_Rn01_00089856 predicted 1437
4 SASI_Rn01_00089857 predicted 1840
5 SASI_Rn01_00089858 predicted 1726
6 SASI_Rn01_00089859 predicted 529
7 SASI_Rn01_00089860 predicted 1534
8 SASI_Rn01_00089861 predicted 1541
9 SASI_Rn01_00089862 predicted 854
10 SASI_Rn02_00269212 predicted 1475
11 SASI_Rn01_00089853 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048263 predicted 1092
2 SASI_Mm01_00048264 predicted 1777
3 SASI_Mm01_00048265 predicted 1438
4 SASI_Mm01_00048266 predicted 1732
5 SASI_Mm01_00048267 predicted 1713
6 SASI_Mm01_00048268 predicted 360
7 SASI_Mm01_00048269 predicted 1185
8 SASI_Mm01_00048270 predicted 1536
9 SASI_Mm01_00048271 predicted 1790
10 SASI_Mm02_00313384 predicted 530
11 SASI_Mm01_00048272 predicted 1878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001523
HAS1 MISSION shRNA Bacterial Glycerol Stock
hyaluronan synthase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-1069s21c1
Sequence:CCGGGCATGCTCAGCATGGGTTATGCTCGAGCATAACCCATGCTGAGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001523.2-1898s21c1
Sequence:CCGGGGGTCAGCCCAAGATTCTTCACTCGAGTGAAGAATCTTGGGCTGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001523.2-1928s21c1
Sequence:CCGGATATTGGGACTGGGACTTCTGCTCGAGCAGAAGTCCCAGTCCCAATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-736s21c1
Sequence:CCGGAGGTCTGTGACTCGGACACAACTCGAGTTGTGTCCGAGTCACAGACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-886s21c1
Sequence:CCGGGATACTGGGTAGCCTTCAATGCTCGAGCATTGAAGGCTACCCAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-1166s21c1
Sequence:CCGGACGCTGGTCCAAGTCGTACTTCTCGAGAAGTACGACTTGGACCAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-921s1c1
Sequence:CCGGCAGAGCTACTTCCACTGTGTACTCGAGTACACAGTGGAAGTAGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-1455s1c1
Sequence:CCGGCCTGCCAAGTTCCTGGCGCTACTCGAGTAGCGCCAGGAACTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-458s1c1
Sequence:CCGGCCTCTACATGGTCGACATGTTCTCGAGAACATGTCGACCATGTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-965s1c1
Sequence:CCGGCCTATATAGGAATAACCTCTTCTCGAGAAGAGGTTATTCCTATATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001523
HAS1 MISSION shRNA shRNA Plasmid DNA
hyaluronan synthase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-1069s21c1
Sequence:CCGGGCATGCTCAGCATGGGTTATGCTCGAGCATAACCCATGCTGAGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001523.2-1898s21c1
Sequence:CCGGGGGTCAGCCCAAGATTCTTCACTCGAGTGAAGAATCTTGGGCTGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001523.2-1928s21c1
Sequence:CCGGATATTGGGACTGGGACTTCTGCTCGAGCAGAAGTCCCAGTCCCAATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-736s21c1
Sequence:CCGGAGGTCTGTGACTCGGACACAACTCGAGTTGTGTCCGAGTCACAGACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-886s21c1
Sequence:CCGGGATACTGGGTAGCCTTCAATGCTCGAGCATTGAAGGCTACCCAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-1166s21c1
Sequence:CCGGACGCTGGTCCAAGTCGTACTTCTCGAGAAGTACGACTTGGACCAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-921s1c1
Sequence:CCGGCAGAGCTACTTCCACTGTGTACTCGAGTACACAGTGGAAGTAGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-1455s1c1
Sequence:CCGGCCTGCCAAGTTCCTGGCGCTACTCGAGTAGCGCCAGGAACTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-458s1c1
Sequence:CCGGCCTCTACATGGTCGACATGTTCTCGAGAACATGTCGACCATGTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-965s1c1
Sequence:CCGGCCTATATAGGAATAACCTCTTCTCGAGAAGAGGTTATTCCTATATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001523
HAS1 MISSION shRNA Lentiviral Transduction Particles
hyaluronan synthase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-1069s21c1
Sequence:CCGGGCATGCTCAGCATGGGTTATGCTCGAGCATAACCCATGCTGAGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414918    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001523.2-1898s21c1
Sequence:CCGGGGGTCAGCCCAAGATTCTTCACTCGAGTGAAGAATCTTGGGCTGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001523.2-1928s21c1
Sequence:CCGGATATTGGGACTGGGACTTCTGCTCGAGCAGAAGTCCCAGTCCCAATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-736s21c1
Sequence:CCGGAGGTCTGTGACTCGGACACAACTCGAGTTGTGTCCGAGTCACAGACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-886s21c1
Sequence:CCGGGATACTGGGTAGCCTTCAATGCTCGAGCATTGAAGGCTACCCAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001523.2-1166s21c1
Sequence:CCGGACGCTGGTCCAAGTCGTACTTCTCGAGAAGTACGACTTGGACCAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-921s1c1
Sequence:CCGGCAGAGCTACTTCCACTGTGTACTCGAGTACACAGTGGAAGTAGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-1455s1c1
Sequence:CCGGCCTGCCAAGTTCCTGGCGCTACTCGAGTAGCGCCAGGAACTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-458s1c1
Sequence:CCGGCCTCTACATGGTCGACATGTTCTCGAGAACATGTCGACCATGTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001523.1-965s1c1
Sequence:CCGGCCTATATAGGAATAACCTCTTCTCGAGAAGAGGTTATTCCTATATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008215
HAS1 MISSION shRNA Bacterial Glycerol Stock
hyaluronan synthase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-109s1c1
Sequence:CCGGCGAGCACTCACGATCATCTTTCTCGAGAAAGATGATCGTGAGTGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1498s1c1
Sequence:CCGGGCGTTGGTTACCATGAATCAACTCGAGTTGATTCATGGTAACCAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-529s1c1
Sequence:CCGGCCCGCCACTTATGTGTGGGATCTCGAGATCCCACACATAAGTGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1194s1c1
Sequence:CCGGCCGCTGGTCCAAATCTTACTTCTCGAGAAGTAAGATTTGGACCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1096s1c1
Sequence:CCGGCGAATGCTTAGCATGGGCTATCTCGAGATAGCCCATGCTAAGCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008215
HAS1 MISSION shRNA shRNA Plasmid DNA
hyaluronan synthase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-109s1c1
Sequence:CCGGCGAGCACTCACGATCATCTTTCTCGAGAAAGATGATCGTGAGTGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1498s1c1
Sequence:CCGGGCGTTGGTTACCATGAATCAACTCGAGTTGATTCATGGTAACCAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-529s1c1
Sequence:CCGGCCCGCCACTTATGTGTGGGATCTCGAGATCCCACACATAAGTGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1194s1c1
Sequence:CCGGCCGCTGGTCCAAATCTTACTTCTCGAGAAGTAAGATTTGGACCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1096s1c1
Sequence:CCGGCGAATGCTTAGCATGGGCTATCTCGAGATAGCCCATGCTAAGCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008215
HAS1 MISSION shRNA Lentiviral Transduction Particles
hyaluronan synthase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-109s1c1
Sequence:CCGGCGAGCACTCACGATCATCTTTCTCGAGAAAGATGATCGTGAGTGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1498s1c1
Sequence:CCGGGCGTTGGTTACCATGAATCAACTCGAGTTGATTCATGGTAACCAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-529s1c1
Sequence:CCGGCCCGCCACTTATGTGTGGGATCTCGAGATCCCACACATAAGTGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1194s1c1
Sequence:CCGGCCGCTGGTCCAAATCTTACTTCTCGAGAAGTAAGATTTGGACCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008215.1-1096s1c1
Sequence:CCGGCGAATGCTTAGCATGGGCTATCTCGAGATAGCCCATGCTAAGCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)