EMAIL THIS PAGE TO A FRIEND

HAS2

hyaluronan synthase 2

117 Gene Product Result for
UniProtKB ID: Q92819, Q32MM3
Gene ID:
Human(3037) Summary: Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]
Mouse(15117) hyaluronan synthase 2
Rat(25694) hyaluronan synthase 2
Zebrafish(260350) hyaluronan synthase 2
domestic cat(101099432) hyaluronan synthase 2
cow(281220) hyaluronan synthase 2
Horse(100009708) hyaluronan synthase 2
dog(482032) hyaluronan synthase 2
chicken(395594) hyaluronan synthase 2
Domestic Rabbit(100008626) hyaluronan synthase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005328 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005328 Rosetta Predictions human pricing
NM_013153 Rosetta Predictions rat pricing
NM_008216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070443 predicted 1970
2 SASI_Hs01_00070444 predicted 868
3 SASI_Hs01_00070447 predicted 955
4 SASI_Hs01_00070448 predicted 1856
5 SASI_Hs01_00070449 predicted 632
6 SASI_Hs02_00339392 predicted 1303
7 SASI_Hs01_00070450 predicted 1534
8 SASI_Hs01_00070451 predicted 1862
9 SASI_Hs02_00339393 predicted 1883
10 SASI_Hs02_00339394 predicted 1455
11 SASI_Hs01_00070445 predicted 903
12 SASI_Hs01_00070446 predicted 1565
13 SASI_Hs01_00070452 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034724 predicted 978
2 SASI_Rn01_00034725 predicted 990
3 SASI_Rn01_00034726 predicted 1509
4 SASI_Rn01_00034727 predicted 1813
5 SASI_Rn01_00034728 predicted 1629
6 SASI_Rn01_00034729 predicted 940
7 SASI_Rn01_00034730 predicted 1410
8 SASI_Rn01_00034731 predicted 1918
9 SASI_Rn01_00034732 predicted 804
10 SASI_Rn01_00034733 predicted 1865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313385 predicted 956
2 SASI_Mm01_00186385 predicted 1233
3 SASI_Mm01_00186386 predicted 930
4 SASI_Mm01_00186387 predicted 1829
5 SASI_Mm01_00186388 predicted 1679
6 SASI_Mm01_00186390 predicted 1028
7 SASI_Mm01_00186391 predicted 1054
8 SASI_Mm01_00186392 predicted 847
9 SASI_Mm01_00186393 predicted 1904
10 SASI_Mm01_00186394 predicted 1945
11 SASI_Mm01_00186389 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005328
HAS2 MISSION shRNA Bacterial Glycerol Stock
hyaluronan synthase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-610s21c1
Sequence:CCGGTGGAATCACAGCTGCTTATATCTCGAGATATAAGCAGCTGTGATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-1280s21c1
Sequence:CCGGTACGATTCCTGGATCTCATTCCTCGAGGAATGAGATCCAGGAATCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-958s21c1
Sequence:CCGGAGACAAATCAGCCACTTATATCTCGAGATATAAGTGGCTGATTTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-1565s21c1
Sequence:CCGGGAATATCTCAGATGGCTAAACCTCGAGGTTTAGCCATCTGAGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-916s1c1
Sequence:CCGGCCTTTACATGATGGACATCTTCTCGAGAAGATGTCCATCATGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-1669s1c1
Sequence:CCGGCGAAGCGATTATCACTGGATTCTCGAGAATCCAGTGATAATCGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-1880s1c1
Sequence:CCGGCCCGCCAAGATGTTTGCAATTCTCGAGAATTGCAAACATCTTGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-637s1c1
Sequence:CCGGCCAGTTTATCCAAACGGATAACTCGAGTTATCCGTTTGGATAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005328
HAS2 MISSION shRNA shRNA Plasmid DNA
hyaluronan synthase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-610s21c1
Sequence:CCGGTGGAATCACAGCTGCTTATATCTCGAGATATAAGCAGCTGTGATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-1280s21c1
Sequence:CCGGTACGATTCCTGGATCTCATTCCTCGAGGAATGAGATCCAGGAATCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-958s21c1
Sequence:CCGGAGACAAATCAGCCACTTATATCTCGAGATATAAGTGGCTGATTTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-1565s21c1
Sequence:CCGGGAATATCTCAGATGGCTAAACCTCGAGGTTTAGCCATCTGAGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-916s1c1
Sequence:CCGGCCTTTACATGATGGACATCTTCTCGAGAAGATGTCCATCATGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-1669s1c1
Sequence:CCGGCGAAGCGATTATCACTGGATTCTCGAGAATCCAGTGATAATCGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-1880s1c1
Sequence:CCGGCCCGCCAAGATGTTTGCAATTCTCGAGAATTGCAAACATCTTGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-637s1c1
Sequence:CCGGCCAGTTTATCCAAACGGATAACTCGAGTTATCCGTTTGGATAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005328
HAS2 MISSION shRNA Lentiviral Transduction Particles
hyaluronan synthase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-610s21c1
Sequence:CCGGTGGAATCACAGCTGCTTATATCTCGAGATATAAGCAGCTGTGATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-1280s21c1
Sequence:CCGGTACGATTCCTGGATCTCATTCCTCGAGGAATGAGATCCAGGAATCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-958s21c1
Sequence:CCGGAGACAAATCAGCCACTTATATCTCGAGATATAAGTGGCTGATTTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005328.2-1565s21c1
Sequence:CCGGGAATATCTCAGATGGCTAAACCTCGAGGTTTAGCCATCTGAGATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-916s1c1
Sequence:CCGGCCTTTACATGATGGACATCTTCTCGAGAAGATGTCCATCATGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-1669s1c1
Sequence:CCGGCGAAGCGATTATCACTGGATTCTCGAGAATCCAGTGATAATCGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-1880s1c1
Sequence:CCGGCCCGCCAAGATGTTTGCAATTCTCGAGAATTGCAAACATCTTGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005328.1-637s1c1
Sequence:CCGGCCAGTTTATCCAAACGGATAACTCGAGTTATCCGTTTGGATAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008216
VALIDATED
HAS2 MISSION shRNA Bacterial Glycerol Stock
hyaluronan synthase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-642s21c1
Sequence:CCGGATATTGTTGGCTACCAGTTTACTCGAGTAAACTGGTAGCCAACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-838s21c1
Sequence:CCGGCCCTGACTACTTACGGAAATGCTCGAGCATTTCCGTAAGTAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008216.3-2417s21c1
Sequence:CCGGTGAGAAGAAAGTCCGATTAAACTCGAGTTTAATCGGACTTTCTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-946s21c1
Sequence:CCGGGGACATATTCAGCGAAGTTATCTCGAGATAACTTCGCTGAATATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008216.3-1520s21c1
Sequence:CCGGAGTCTGGGCTATGCAACTAAACTCGAGTTTAGTTGCATAGCCCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-1964s1c1
Sequence:CCGGCAATCCTTCTAGGTGGTGTAACTCGAGTTACACCACCTAGAAGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008216.2-3409s1c1
Sequence:CCGGCCTGCCTGTTAGTGATGTTTACTCGAGTAAACATCACTAACAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-1852s1c1
Sequence:CCGGCCTGCCAAGATGTTTGCAATTCTCGAGAATTGCAAACATCTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-793s1c1
Sequence:CCGGCCTGACTACTTACGGAAATGTCTCGAGACATTTCCGTAAGTAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-888s1c1
Sequence:CCGGCCTTTACATGATGGACATATTCTCGAGAATATGTCCATCATGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008216
VALIDATED
HAS2 MISSION shRNA shRNA Plasmid DNA
hyaluronan synthase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-642s21c1
Sequence:CCGGATATTGTTGGCTACCAGTTTACTCGAGTAAACTGGTAGCCAACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-838s21c1
Sequence:CCGGCCCTGACTACTTACGGAAATGCTCGAGCATTTCCGTAAGTAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008216.3-2417s21c1
Sequence:CCGGTGAGAAGAAAGTCCGATTAAACTCGAGTTTAATCGGACTTTCTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-946s21c1
Sequence:CCGGGGACATATTCAGCGAAGTTATCTCGAGATAACTTCGCTGAATATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008216.3-1520s21c1
Sequence:CCGGAGTCTGGGCTATGCAACTAAACTCGAGTTTAGTTGCATAGCCCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-1964s1c1
Sequence:CCGGCAATCCTTCTAGGTGGTGTAACTCGAGTTACACCACCTAGAAGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008216.2-3409s1c1
Sequence:CCGGCCTGCCTGTTAGTGATGTTTACTCGAGTAAACATCACTAACAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-1852s1c1
Sequence:CCGGCCTGCCAAGATGTTTGCAATTCTCGAGAATTGCAAACATCTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-793s1c1
Sequence:CCGGCCTGACTACTTACGGAAATGTCTCGAGACATTTCCGTAAGTAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-888s1c1
Sequence:CCGGCCTTTACATGATGGACATATTCTCGAGAATATGTCCATCATGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008216
VALIDATED
HAS2 MISSION shRNA Lentiviral Transduction Particles
hyaluronan synthase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-642s21c1
Sequence:CCGGATATTGTTGGCTACCAGTTTACTCGAGTAAACTGGTAGCCAACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-838s21c1
Sequence:CCGGCCCTGACTACTTACGGAAATGCTCGAGCATTTCCGTAAGTAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008216.3-2417s21c1
Sequence:CCGGTGAGAAGAAAGTCCGATTAAACTCGAGTTTAATCGGACTTTCTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008216.3-946s21c1
Sequence:CCGGGGACATATTCAGCGAAGTTATCTCGAGATAACTTCGCTGAATATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_008216.3-1520s21c1
Sequence:CCGGAGTCTGGGCTATGCAACTAAACTCGAGTTTAGTTGCATAGCCCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-1964s1c1
Sequence:CCGGCAATCCTTCTAGGTGGTGTAACTCGAGTTACACCACCTAGAAGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008216.2-3409s1c1
Sequence:CCGGCCTGCCTGTTAGTGATGTTTACTCGAGTAAACATCACTAACAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-1852s1c1
Sequence:CCGGCCTGCCAAGATGTTTGCAATTCTCGAGAATTGCAAACATCTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-793s1c1
Sequence:CCGGCCTGACTACTTACGGAAATGTCTCGAGACATTTCCGTAAGTAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008216.2-888s1c1
Sequence:CCGGCCTTTACATGATGGACATATTCTCGAGAATATGTCCATCATGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)