EMAIL THIS PAGE TO A FRIEND

HAS3

hyaluronan synthase 3

173 Gene Product Result for
UniProtKB ID: O00219, A8K5T5, Q8WTZ0, Q9NYP0
Gene ID:
Human(3038) Summary: The protein encoded by this gene is involved in the synthesis of the unbranched glycosaminoglycan hyaluronan, or hyaluronic acid, which is a major constituent of the extracellular matrix. This gene is a member of the NODC/HAS gene family. Compared to the proteins encoded by other members of this gene family, this protein appears to be more of a regulator of hyaluronan synthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(15118) hyaluronan synthase 3
Rat(266805) hyaluronan synthase 3
sheep(101120264) hyaluronan synthase 3
Domestic Rabbit(100009454) hyaluronan synthase 3
domestic guinea pig(100725931) hyaluronan synthase 3
naked mole-rat(101717946) hyaluronan synthase 3
Zebrafish(282555) hyaluronan synthase 3
cow(286824) hyaluronan synthase 3
Horse(100066947) hyaluronan synthase 3
domestic cat(101096124) hyaluronan synthase 3
dog(489739) hyaluronan synthase 3
chicken(427564) hyaluronan synthase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005329 Rosetta Predictions human pricing
NM_138612 Rosetta Predictions human pricing
NM_172319 Rosetta Predictions rat pricing
NM_008217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053178 predicted 436
2 SASI_Hs01_00053179 predicted 478
3 SASI_Hs02_00339395 predicted 594
4 SASI_Hs01_00053180 predicted 577
5 SASI_Hs01_00053181 predicted 409
6 SASI_Hs01_00053182 predicted 664
7 SASI_Hs01_00053183 predicted 407
8 SASI_Hs01_00053184 predicted 665
9 SASI_Hs02_00339396 predicted 472
10 SASI_Hs01_00053185 predicted 446
11 SASI_Hs01_00053186 predicted 536
12 SASI_Hs01_00053187 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125524 predicted 343
2 SASI_Hs01_00125525 predicted 384
3 SASI_Hs02_00363738 predicted 493
4 SASI_Hs01_00125526 predicted 480
5 SASI_Hs01_00125527 predicted 318
6 SASI_Hs01_00125528 predicted 566
7 SASI_Hs01_00125529 predicted 313
8 SASI_Hs01_00125530 predicted 574
9 SASI_Hs02_00363739 predicted 379
10 SASI_Hs01_00125531 predicted 352
11 SASI_Hs01_00125532 predicted 431
12 SASI_Hs01_00125533 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269206 predicted 613
2 SASI_Rn01_00095572 predicted 269
3 SASI_Rn01_00095573 predicted 270
4 SASI_Rn01_00095574 predicted 846
5 SASI_Rn01_00095575 predicted 772
6 SASI_Rn01_00095576 predicted 1207
7 SASI_Rn01_00095577 predicted 206
8 SASI_Rn01_00095578 predicted 1424
9 SASI_Rn01_00095579 predicted 529
10 SASI_Rn01_00095580 predicted 1490
11 SASI_Rn01_00095581 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139543 predicted 618
2 SASI_Mm01_00139544 predicted 1912
3 SASI_Mm01_00139545 predicted 856
4 SASI_Mm01_00139546 predicted 216
5 SASI_Mm01_00139547 predicted 903
6 SASI_Mm01_00139548 predicted 1433
7 SASI_Mm01_00139550 predicted 1351
8 SASI_Mm01_00139551 predicted 527
9 SASI_Mm01_00139552 predicted 1831
10 SASI_Mm02_00313386 predicted 563
11 SASI_Mm01_00139549 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005329
HAS3 MISSION shRNA Bacterial Glycerol Stock
hyaluronan synthase 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1526s1c1
Sequence:CCGGCCATTGCTACCATCAACAAATCTCGAGATTTGTTGATGGTAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1329s1c1
Sequence:CCGGCTTCCTCATTGCCACGGTTATCTCGAGATAACCGTGGCAATGAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-320s1c1
Sequence:CCGGACCTGCTCATTCAGAGCCTTTCTCGAGAAAGGCTCTGAATGAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1251s1c1
Sequence:CCGGGCTCTACAACTCTCTGTGGTTCTCGAGAACCACAGAGAGTTGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005329.2-2118s21c1
Sequence:CCGGGTTGTGCTAAACCAAGTTAAGCTCGAGCTTAACTTGGTTTAGCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005329.2-1136s21c1
Sequence:CCGGTTGGCTACCGAACTAAGTATACTCGAGTATACTTAGTTCGGTAGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005329.2-1637s21c1
Sequence:CCGGGGCTGGCCTACACAGCTTATTCTCGAGAATAAGCTGTGTAGGCCAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005329
HAS3 MISSION shRNA shRNA Plasmid DNA
hyaluronan synthase 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1526s1c1
Sequence:CCGGCCATTGCTACCATCAACAAATCTCGAGATTTGTTGATGGTAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1329s1c1
Sequence:CCGGCTTCCTCATTGCCACGGTTATCTCGAGATAACCGTGGCAATGAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-320s1c1
Sequence:CCGGACCTGCTCATTCAGAGCCTTTCTCGAGAAAGGCTCTGAATGAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1251s1c1
Sequence:CCGGGCTCTACAACTCTCTGTGGTTCTCGAGAACCACAGAGAGTTGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005329.2-2118s21c1
Sequence:CCGGGTTGTGCTAAACCAAGTTAAGCTCGAGCTTAACTTGGTTTAGCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005329.2-1136s21c1
Sequence:CCGGTTGGCTACCGAACTAAGTATACTCGAGTATACTTAGTTCGGTAGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005329.2-1637s21c1
Sequence:CCGGGGCTGGCCTACACAGCTTATTCTCGAGAATAAGCTGTGTAGGCCAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005329
HAS3 MISSION shRNA Lentiviral Transduction Particles
hyaluronan synthase 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1526s1c1
Sequence:CCGGCCATTGCTACCATCAACAAATCTCGAGATTTGTTGATGGTAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1329s1c1
Sequence:CCGGCTTCCTCATTGCCACGGTTATCTCGAGATAACCGTGGCAATGAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-320s1c1
Sequence:CCGGACCTGCTCATTCAGAGCCTTTCTCGAGAAAGGCTCTGAATGAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005329.2-1251s1c1
Sequence:CCGGGCTCTACAACTCTCTGTGGTTCTCGAGAACCACAGAGAGTTGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005329.2-2118s21c1
Sequence:CCGGGTTGTGCTAAACCAAGTTAAGCTCGAGCTTAACTTGGTTTAGCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005329.2-1136s21c1
Sequence:CCGGTTGGCTACCGAACTAAGTATACTCGAGTATACTTAGTTCGGTAGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005329.2-1637s21c1
Sequence:CCGGGGCTGGCCTACACAGCTTATTCTCGAGAATAAGCTGTGTAGGCCAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008217
HAS3 MISSION shRNA Bacterial Glycerol Stock
hyaluronan synthase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1017s1c1
Sequence:CCGGGCAATGTATTAGTGGGCCTTTCTCGAGAAAGGCCCACTAATACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-555s1c1
Sequence:CCGGCCAGGAAGATACCTACATGTTCTCGAGAACATGTAGGTATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1250s1c1
Sequence:CCGGGCAAGTCTTACTTTCGGGAATCTCGAGATTCCCGAAAGTAAGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1602s1c1
Sequence:CCGGCGTGAACTTCATTGGCCTAATCTCGAGATTAGGCCAATGAAGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008217.2-1949s1c1
Sequence:CCGGCCGATCTGAAACGCAAAGAATCTCGAGATTCTTTGCGTTTCAGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008217.4-1762s21c1
Sequence:CCGGTGCTGTATCTGGCCATTATTGCTCGAGCAATAATGGCCAGATACAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008217.4-1156s21c1
Sequence:CCGGTTGGCTACCGGACTAAGTATACTCGAGTATACTTAGTCCGGTAGCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008217.4-2294s21c1
Sequence:CCGGGATTAGCCATCAATGCGTTAACTCGAGTTAACGCATTGATGGCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008217
HAS3 MISSION shRNA shRNA Plasmid DNA
hyaluronan synthase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1017s1c1
Sequence:CCGGGCAATGTATTAGTGGGCCTTTCTCGAGAAAGGCCCACTAATACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-555s1c1
Sequence:CCGGCCAGGAAGATACCTACATGTTCTCGAGAACATGTAGGTATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1250s1c1
Sequence:CCGGGCAAGTCTTACTTTCGGGAATCTCGAGATTCCCGAAAGTAAGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1602s1c1
Sequence:CCGGCGTGAACTTCATTGGCCTAATCTCGAGATTAGGCCAATGAAGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008217.2-1949s1c1
Sequence:CCGGCCGATCTGAAACGCAAAGAATCTCGAGATTCTTTGCGTTTCAGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008217.4-1762s21c1
Sequence:CCGGTGCTGTATCTGGCCATTATTGCTCGAGCAATAATGGCCAGATACAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008217.4-1156s21c1
Sequence:CCGGTTGGCTACCGGACTAAGTATACTCGAGTATACTTAGTCCGGTAGCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008217.4-2294s21c1
Sequence:CCGGGATTAGCCATCAATGCGTTAACTCGAGTTAACGCATTGATGGCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008217
HAS3 MISSION shRNA Lentiviral Transduction Particles
hyaluronan synthase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1017s1c1
Sequence:CCGGGCAATGTATTAGTGGGCCTTTCTCGAGAAAGGCCCACTAATACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-555s1c1
Sequence:CCGGCCAGGAAGATACCTACATGTTCTCGAGAACATGTAGGTATCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1250s1c1
Sequence:CCGGGCAAGTCTTACTTTCGGGAATCTCGAGATTCCCGAAAGTAAGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008217.2-1602s1c1
Sequence:CCGGCGTGAACTTCATTGGCCTAATCTCGAGATTAGGCCAATGAAGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076263    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008217.2-1949s1c1
Sequence:CCGGCCGATCTGAAACGCAAAGAATCTCGAGATTCTTTGCGTTTCAGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008217.4-1762s21c1
Sequence:CCGGTGCTGTATCTGGCCATTATTGCTCGAGCAATAATGGCCAGATACAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008217.4-1156s21c1
Sequence:CCGGTTGGCTACCGGACTAAGTATACTCGAGTATACTTAGTCCGGTAGCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008217.4-2294s21c1
Sequence:CCGGGATTAGCCATCAATGCGTTAACTCGAGTTAACGCATTGATGGCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)