EMAIL THIS PAGE TO A FRIEND

HAT1

histone acetyltransferase 1

82 Gene Product Result for
Synonyms: KAT1
UniProtKB ID: O14929, Q49A44, Q53QF0, Q53SU4, Q6P594, Q8WWB9
Gene ID:
Human(8520) Summary: The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
Mouse(107435) histone aminotransferase 1
Rat(296501) histone acetyltransferase 1
Zebrafish(447833) histone acetyltransferase 1
cow(509329) histone acetyltransferase 1
Thale Cress(827457) homeobox-leucine zipper protein HAT1
chicken(374037) histone acetyltransferase 1
domestic cat(101091131) histone acetyltransferase 1
dog(478799) histone acetyltransferase 1
domestic guinea pig(100732060) histone acetyltransferase 1
naked mole-rat(101702952) histone acetyltransferase 1
Goat(100861370) histone acetyltransferase 1
sheep(101114588) histone acetyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
A2181 Acetyl coenzyme A lithium salt ≥93% (HPLC) human, mouse, rat pricing
A2056 Acetyl coenzyme A sodium salt ≥93% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026115 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026115 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026115 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003642 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033085 Rosetta Predictions human pricing
NM_003642 Rosetta Predictions human pricing
NM_001009657 Rosetta Predictions rat pricing
NM_026115 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076399 predicted 392
2 SASI_Hs01_00076400 predicted 1042
3 SASI_Hs01_00076402 predicted 1189
4 SASI_Hs02_00307998 predicted 1079
5 SASI_Hs01_00076403 predicted 472
6 SASI_Hs01_00076404 predicted 462
7 SASI_Hs01_00076405 predicted 614
8 SASI_Hs01_00076406 predicted 562
9 SASI_Hs01_00076407 predicted 645
10 SASI_Hs01_00076408 predicted 1228
11 SASI_Hs01_00076401 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128331 predicted 467
2 SASI_Hs01_00128332 predicted 1125
3 SASI_Hs01_00128334 predicted 1270
4 SASI_Hs02_00336002 predicted 1149
5 SASI_Hs01_00128335 predicted 550
6 SASI_Hs01_00128336 predicted 537
7 SASI_Hs01_00128337 predicted 691
8 SASI_Hs01_00128338 predicted 633
9 SASI_Hs01_00128339 predicted 720
10 SASI_Hs01_00128340 predicted 1304
11 SASI_Hs01_00128333 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101013 predicted 880
2 SASI_Rn01_00101014 predicted 638
3 SASI_Rn01_00101015 predicted 829
4 SASI_Rn01_00101016 predicted 755
5 SASI_Rn01_00101017 predicted 286
6 SASI_Rn01_00101018 predicted 692
7 SASI_Rn01_00101019 predicted 523
8 SASI_Rn01_00101020 predicted 876
9 SASI_Rn01_00101021 predicted 537
10 SASI_Rn01_00101022 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026115 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329694 predicted 1341
2 SASI_Mm01_00182490 predicted 1360
3 SASI_Mm01_00182491 predicted 290
4 SASI_Mm01_00182493 predicted 750
5 SASI_Mm01_00182494 predicted 688
6 SASI_Mm01_00182495 predicted 1007
7 SASI_Mm01_00182496 predicted 1177
8 SASI_Mm01_00182497 predicted 531
9 SASI_Mm01_00182498 predicted 1075
10 SASI_Mm01_00182499 predicted 463
11 SASI_Mm01_00182492 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026115
VALIDATED
HAT1 MISSION shRNA Bacterial Glycerol Stock
histone acetyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-294s1c1
Sequence:CCGGCCGTGTTGAATATTCATCTAACTCGAGTTAGATGAATATTCAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026115.2-598s1c1
Sequence:CCGGGCTAGCTTTATTGACGTGGATCTCGAGATCCACGTCAATAAAGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-869s1c1
Sequence:CCGGCCAGAAGCTATTTGAAACTAACTCGAGTTAGTTTCAAATAGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-951s1c1
Sequence:CCGGGCAAGGATTCAGTGAAGATATCTCGAGATATCTTCACTGAATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-1008s1c1
Sequence:CCGGGCAACATGCTAGAAGGGTTTACTCGAGTAAACCCTTCTAGCATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-249s21c1
Sequence:CCGGGAAGATCTTGCTGTACTATATCTCGAGATATAGTACAGCAAGATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-862s21c1
Sequence:CCGGGATCCGTCCAGAAGCTATTTGCTCGAGCAAATAGCTTCTGGACGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-1340s21c1
Sequence:CCGGTGAACCTCTGATGACCCTAAACTCGAGTTTAGGGTCATCAGAGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-1079s21c1
Sequence:CCGGGAAGCTACAGACTGGATATTACTCGAGTAATATCCAGTCTGTAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-534s21c1
Sequence:CCGGATGTAGAGGCTTTCGAGAATACTCGAGTATTCTCGAAAGCCTCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026115
VALIDATED
HAT1 MISSION shRNA shRNA Plasmid DNA
histone acetyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-294s1c1
Sequence:CCGGCCGTGTTGAATATTCATCTAACTCGAGTTAGATGAATATTCAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026115.2-598s1c1
Sequence:CCGGGCTAGCTTTATTGACGTGGATCTCGAGATCCACGTCAATAAAGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-869s1c1
Sequence:CCGGCCAGAAGCTATTTGAAACTAACTCGAGTTAGTTTCAAATAGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-951s1c1
Sequence:CCGGGCAAGGATTCAGTGAAGATATCTCGAGATATCTTCACTGAATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-1008s1c1
Sequence:CCGGGCAACATGCTAGAAGGGTTTACTCGAGTAAACCCTTCTAGCATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-249s21c1
Sequence:CCGGGAAGATCTTGCTGTACTATATCTCGAGATATAGTACAGCAAGATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-862s21c1
Sequence:CCGGGATCCGTCCAGAAGCTATTTGCTCGAGCAAATAGCTTCTGGACGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-1340s21c1
Sequence:CCGGTGAACCTCTGATGACCCTAAACTCGAGTTTAGGGTCATCAGAGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-1079s21c1
Sequence:CCGGGAAGCTACAGACTGGATATTACTCGAGTAATATCCAGTCTGTAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-534s21c1
Sequence:CCGGATGTAGAGGCTTTCGAGAATACTCGAGTATTCTCGAAAGCCTCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026115
VALIDATED
HAT1 MISSION shRNA Lentiviral Transduction Particles
histone acetyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-294s1c1
Sequence:CCGGCCGTGTTGAATATTCATCTAACTCGAGTTAGATGAATATTCAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026115.2-598s1c1
Sequence:CCGGGCTAGCTTTATTGACGTGGATCTCGAGATCCACGTCAATAAAGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-869s1c1
Sequence:CCGGCCAGAAGCTATTTGAAACTAACTCGAGTTAGTTTCAAATAGCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-951s1c1
Sequence:CCGGGCAAGGATTCAGTGAAGATATCTCGAGATATCTTCACTGAATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026115.2-1008s1c1
Sequence:CCGGGCAACATGCTAGAAGGGTTTACTCGAGTAAACCCTTCTAGCATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-249s21c1
Sequence:CCGGGAAGATCTTGCTGTACTATATCTCGAGATATAGTACAGCAAGATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-862s21c1
Sequence:CCGGGATCCGTCCAGAAGCTATTTGCTCGAGCAAATAGCTTCTGGACGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231311    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-1340s21c1
Sequence:CCGGTGAACCTCTGATGACCCTAAACTCGAGTTTAGGGTCATCAGAGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-1079s21c1
Sequence:CCGGGAAGCTACAGACTGGATATTACTCGAGTAATATCCAGTCTGTAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026115.3-534s21c1
Sequence:CCGGATGTAGAGGCTTTCGAGAATACTCGAGTATTCTCGAAAGCCTCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003642
VALIDATED
HAT1 MISSION shRNA Bacterial Glycerol Stock
histone acetyltransferase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-1264s1c1
Sequence:CCGGCGGCGTGTTATTGAACGACTTCTCGAGAAGTCGTTCAATAACACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-695s1c1
Sequence:CCGGGCTACATGACAGTCTATAATTCTCGAGAATTATAGACTGTCATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-297s1c1
Sequence:CCGGCCGTGTTGAATATGCATCTAACTCGAGTTAGATGCATATTCAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-954s1c1
Sequence:CCGGGCAAGGATTCAATGAAGATATCTCGAGATATCTTCATTGAATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-314s21c1
Sequence:CCGGCCGTGTTGAATATGCATCTAACTCGAGTTAGATGCATATTCAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-712s21c1
Sequence:CCGGGCTACATGACAGTCTATAATTCTCGAGAATTATAGACTGTCATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-971s21c1
Sequence:CCGGGCAAGGATTCAATGAAGATATCTCGAGATATCTTCATTGAATCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-1281s21c1
Sequence:CCGGCGGCGTGTTATTGAACGACTTCTCGAGAAGTCGTTCAATAACACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-363s21c1
Sequence:CCGGGCAGATGATGTTGAGGGCAAACTCGAGTTTGCCCTCAACATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003642
VALIDATED
HAT1 MISSION shRNA shRNA Plasmid DNA
histone acetyltransferase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-1264s1c1
Sequence:CCGGCGGCGTGTTATTGAACGACTTCTCGAGAAGTCGTTCAATAACACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-695s1c1
Sequence:CCGGGCTACATGACAGTCTATAATTCTCGAGAATTATAGACTGTCATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-297s1c1
Sequence:CCGGCCGTGTTGAATATGCATCTAACTCGAGTTAGATGCATATTCAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-954s1c1
Sequence:CCGGGCAAGGATTCAATGAAGATATCTCGAGATATCTTCATTGAATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-314s21c1
Sequence:CCGGCCGTGTTGAATATGCATCTAACTCGAGTTAGATGCATATTCAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-712s21c1
Sequence:CCGGGCTACATGACAGTCTATAATTCTCGAGAATTATAGACTGTCATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-971s21c1
Sequence:CCGGGCAAGGATTCAATGAAGATATCTCGAGATATCTTCATTGAATCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-1281s21c1
Sequence:CCGGCGGCGTGTTATTGAACGACTTCTCGAGAAGTCGTTCAATAACACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-363s21c1
Sequence:CCGGGCAGATGATGTTGAGGGCAAACTCGAGTTTGCCCTCAACATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003642
VALIDATED
HAT1 MISSION shRNA Lentiviral Transduction Particles
histone acetyltransferase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-1264s1c1
Sequence:CCGGCGGCGTGTTATTGAACGACTTCTCGAGAAGTCGTTCAATAACACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-695s1c1
Sequence:CCGGGCTACATGACAGTCTATAATTCTCGAGAATTATAGACTGTCATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-297s1c1
Sequence:CCGGCCGTGTTGAATATGCATCTAACTCGAGTTAGATGCATATTCAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_003642.1-954s1c1
Sequence:CCGGGCAAGGATTCAATGAAGATATCTCGAGATATCTTCATTGAATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-314s21c1
Sequence:CCGGCCGTGTTGAATATGCATCTAACTCGAGTTAGATGCATATTCAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-712s21c1
Sequence:CCGGGCTACATGACAGTCTATAATTCTCGAGAATTATAGACTGTCATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-971s21c1
Sequence:CCGGGCAAGGATTCAATGAAGATATCTCGAGATATCTTCATTGAATCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-1281s21c1
Sequence:CCGGCGGCGTGTTATTGAACGACTTCTCGAGAAGTCGTTCAATAACACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003642.2-363s21c1
Sequence:CCGGGCAGATGATGTTGAGGGCAAACTCGAGTTTGCCCTCAACATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)