EMAIL THIS PAGE TO A FRIEND

HAUS1

HAUS augmin-like complex, subunit 1

59 Gene Product Result for
Synonyms: CCDC5 HEI-C HEIC HsT1461
UniProtKB ID: Q96CS2, B2RDM7, Q8N837
Gene ID:
Human(115106) Summary: HAUS1 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]
Mouse(225745) HAUS augmin-like complex, subunit 1
Rat(192228) HAUS augmin-like complex, subunit 1
Zebrafish(553389) HAUS augmin-like complex, subunit 1
cow(528378) HAUS augmin-like complex, subunit 1
chicken(416380) HAUS augmin-like complex, subunit 1
dog(480148) HAUS augmin-like complex, subunit 1
domestic cat(101080669) HAUS augmin-like complex, subunit 1
sheep(101111849) HAUS augmin-like complex, subunit 1
domestic guinea pig(100729560) HAUS augmin-like complex, subunit 1
naked mole-rat(101705432) HAUS augmin-like complex, subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138443 Rosetta Predictions human pricing
NM_138864 Rosetta Predictions rat pricing
NM_146089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107510 predicted 322
2 SASI_Hs01_00107511 predicted 420
3 SASI_Hs01_00107512 predicted 587
4 SASI_Hs01_00107513 predicted 555
5 SASI_Hs02_00363607 predicted 666
6 SASI_Hs01_00107514 predicted 849
7 SASI_Hs01_00107515 predicted 511
8 SASI_Hs01_00107516 predicted 843
9 SASI_Hs01_00107517 predicted 377
10 SASI_Hs01_00107518 predicted 778
11 SASI_Hs01_00107519 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117046 predicted 933
2 SASI_Rn01_00117038 predicted 715
3 SASI_Rn02_00268272 predicted 192
4 SASI_Rn01_00117039 predicted 316
5 SASI_Rn01_00117040 predicted 367
6 SASI_Rn02_00268273 predicted 218
7 SASI_Rn01_00117041 predicted 701
8 SASI_Rn01_00117042 predicted 1025
9 SASI_Rn02_00268274 predicted 982
10 SASI_Rn01_00117045 predicted 749
11 SASI_Rn01_00117043 predicted 967
12 SASI_Rn01_00117044 predicted 971
13 SASI_Rn01_00117047 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041634 predicted 567
2 SASI_Mm01_00041635 predicted 333
3 SASI_Mm01_00041636 predicted 741
4 SASI_Mm01_00041637 predicted 729
5 SASI_Mm01_00041638 predicted 427
6 SASI_Mm01_00041639 predicted 228
7 SASI_Mm01_00041640 predicted 675
8 SASI_Mm01_00041641 predicted 555
9 SASI_Mm01_00041642 predicted 236
10 SASI_Mm02_00341723 predicted 300
11 SASI_Mm01_00041643 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138443
VALIDATED
HAUS1 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-958s1c1
Sequence:CCGGCCTCTTGGCATTTCCTAATAACTCGAGTTATTAGGAAATGCCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-197s1c1
Sequence:CCGGCAGGGATGTCTACCTGGTAATCTCGAGATTACCAGGTAGACATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-588s1c1
Sequence:CCGGCGTCAGAACATGGACTTTCTACTCGAGTAGAAAGTCCATGTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-831s1c1
Sequence:CCGGCGAGAACTAGATAGCATTGAACTCGAGTTCAATGCTATCTAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-237s1c1
Sequence:CCGGGCAAGTGAATACGAGTCAGAACTCGAGTTCTGACTCGTATTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-615s21c1
Sequence:CCGGCGTCAGAACATGGACTTTCTACTCGAGTAGAAAGTCCATGTTCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-264s21c1
Sequence:CCGGGCAAGTGAATACGAGTCAGAACTCGAGTTCTGACTCGTATTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-858s21c1
Sequence:CCGGCGAGAACTAGATAGCATTGAACTCGAGTTCAATGCTATCTAGTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138443.3-985s21c1
Sequence:CCGGCCTCTTGGCATTTCCTAATAACTCGAGTTATTAGGAAATGCCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-224s21c1
Sequence:CCGGCAGGGATGTCTACCTGGTAATCTCGAGATTACCAGGTAGACATCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138443
VALIDATED
HAUS1 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-958s1c1
Sequence:CCGGCCTCTTGGCATTTCCTAATAACTCGAGTTATTAGGAAATGCCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-197s1c1
Sequence:CCGGCAGGGATGTCTACCTGGTAATCTCGAGATTACCAGGTAGACATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-588s1c1
Sequence:CCGGCGTCAGAACATGGACTTTCTACTCGAGTAGAAAGTCCATGTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-831s1c1
Sequence:CCGGCGAGAACTAGATAGCATTGAACTCGAGTTCAATGCTATCTAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-237s1c1
Sequence:CCGGGCAAGTGAATACGAGTCAGAACTCGAGTTCTGACTCGTATTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-615s21c1
Sequence:CCGGCGTCAGAACATGGACTTTCTACTCGAGTAGAAAGTCCATGTTCTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-264s21c1
Sequence:CCGGGCAAGTGAATACGAGTCAGAACTCGAGTTCTGACTCGTATTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-858s21c1
Sequence:CCGGCGAGAACTAGATAGCATTGAACTCGAGTTCAATGCTATCTAGTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138443.3-985s21c1
Sequence:CCGGCCTCTTGGCATTTCCTAATAACTCGAGTTATTAGGAAATGCCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-224s21c1
Sequence:CCGGCAGGGATGTCTACCTGGTAATCTCGAGATTACCAGGTAGACATCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138443
VALIDATED
HAUS1 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-958s1c1
Sequence:CCGGCCTCTTGGCATTTCCTAATAACTCGAGTTATTAGGAAATGCCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-197s1c1
Sequence:CCGGCAGGGATGTCTACCTGGTAATCTCGAGATTACCAGGTAGACATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-588s1c1
Sequence:CCGGCGTCAGAACATGGACTTTCTACTCGAGTAGAAAGTCCATGTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-831s1c1
Sequence:CCGGCGAGAACTAGATAGCATTGAACTCGAGTTCAATGCTATCTAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_138443.2-237s1c1
Sequence:CCGGGCAAGTGAATACGAGTCAGAACTCGAGTTCTGACTCGTATTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-615s21c1
Sequence:CCGGCGTCAGAACATGGACTTTCTACTCGAGTAGAAAGTCCATGTTCTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-264s21c1
Sequence:CCGGGCAAGTGAATACGAGTCAGAACTCGAGTTCTGACTCGTATTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-858s21c1
Sequence:CCGGCGAGAACTAGATAGCATTGAACTCGAGTTCAATGCTATCTAGTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138443.3-985s21c1
Sequence:CCGGCCTCTTGGCATTTCCTAATAACTCGAGTTATTAGGAAATGCCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138443.3-224s21c1
Sequence:CCGGCAGGGATGTCTACCTGGTAATCTCGAGATTACCAGGTAGACATCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146089
VALIDATED
HAUS1 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-253s1c1
Sequence:CCGGCTTTCTCATGGAGAGTGTGAACTCGAGTTCACACTCTCCATGAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-830s1c1
Sequence:CCGGGCTGAACTTACCAAGAAAGTACTCGAGTACTTTCTTGGTAAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-215s21c1
Sequence:CCGGGCAAGTGAATATGAATCCGAACTCGAGTTCGGATTCATATTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-830s21c1
Sequence:CCGGGCTGAACTTACCAAGAAAGTACTCGAGTACTTTCTTGGTAAGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146089.1-566s1c1
Sequence:CCGGCTTCAGAATATGGACTTCCTACTCGAGTAGGAAGTCCATATTCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-215s1c1
Sequence:CCGGGCAAGTGAATATGAATCCGAACTCGAGTTCGGATTCATATTCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-177s21c1
Sequence:CCGGGGGACATCAGCCTGGTAATAGCTCGAGCTATTACCAGGCTGATGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-253s21c1
Sequence:CCGGCTTTCTCATGGAGAGTGTGAACTCGAGTTCACACTCTCCATGAGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146089
VALIDATED
HAUS1 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-253s1c1
Sequence:CCGGCTTTCTCATGGAGAGTGTGAACTCGAGTTCACACTCTCCATGAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-830s1c1
Sequence:CCGGGCTGAACTTACCAAGAAAGTACTCGAGTACTTTCTTGGTAAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-215s21c1
Sequence:CCGGGCAAGTGAATATGAATCCGAACTCGAGTTCGGATTCATATTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-830s21c1
Sequence:CCGGGCTGAACTTACCAAGAAAGTACTCGAGTACTTTCTTGGTAAGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146089.1-566s1c1
Sequence:CCGGCTTCAGAATATGGACTTCCTACTCGAGTAGGAAGTCCATATTCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-215s1c1
Sequence:CCGGGCAAGTGAATATGAATCCGAACTCGAGTTCGGATTCATATTCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-177s21c1
Sequence:CCGGGGGACATCAGCCTGGTAATAGCTCGAGCTATTACCAGGCTGATGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-253s21c1
Sequence:CCGGCTTTCTCATGGAGAGTGTGAACTCGAGTTCACACTCTCCATGAGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146089
VALIDATED
HAUS1 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-253s1c1
Sequence:CCGGCTTTCTCATGGAGAGTGTGAACTCGAGTTCACACTCTCCATGAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-830s1c1
Sequence:CCGGGCTGAACTTACCAAGAAAGTACTCGAGTACTTTCTTGGTAAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-215s21c1
Sequence:CCGGGCAAGTGAATATGAATCCGAACTCGAGTTCGGATTCATATTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-830s21c1
Sequence:CCGGGCTGAACTTACCAAGAAAGTACTCGAGTACTTTCTTGGTAAGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146089.1-566s1c1
Sequence:CCGGCTTCAGAATATGGACTTCCTACTCGAGTAGGAAGTCCATATTCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146089.1-215s1c1
Sequence:CCGGGCAAGTGAATATGAATCCGAACTCGAGTTCGGATTCATATTCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-177s21c1
Sequence:CCGGGGGACATCAGCCTGGTAATAGCTCGAGCTATTACCAGGCTGATGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146089.2-253s21c1
Sequence:CCGGCTTTCTCATGGAGAGTGTGAACTCGAGTTCACACTCTCCATGAGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)