EMAIL THIS PAGE TO A FRIEND

HAUS3

HAUS augmin-like complex, subunit 3

97 Gene Product Result for
Synonyms: C4orf15 IT1 dgt3
UniProtKB ID: Q68CZ6, O43606, Q8TAZ5, Q9BTJ9
Gene ID:
Human(79441) Summary: HAUS3 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]
Mouse(231123) HAUS augmin-like complex, subunit 3
Rat(680477) HAUS augmin-like complex, subunit 3
sheep(101110940) HAUS augmin-like complex, subunit 3
domestic guinea pig(100732760) HAUS augmin-like complex, subunit 3
naked mole-rat(101706730) HAUS augmin-like complex, subunit 3
Zebrafish(566923) HAUS augmin-like complex, subunit 3
chicken(771514) HAUS augmin-like complex, subunit 3
dog(100688432) HAUS augmin-like complex, subunit 3
cow(789559) HAUS augmin-like complex, subunit 3
Horse(100051235) HAUS augmin-like complex, subunit 3
domestic cat(101096232) HAUS augmin-like complex, subunit 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU151691 MISSION® esiRNA esiRNA targeting mouse Haus3 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024511 Rosetta Predictions human pricing
NM_001109412 Rosetta Predictions rat pricing
NM_146159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073692 predicted 1253
2 SASI_Hs01_00073693 predicted 2014
3 SASI_Hs02_00356779 predicted 1514
4 SASI_Hs01_00073695 predicted 2136
5 SASI_Hs01_00073696 predicted 1482
6 SASI_Hs01_00073698 predicted 1798
7 SASI_Hs01_00073699 predicted 1382
8 SASI_Hs01_00073700 predicted 1795
9 SASI_Hs01_00073701 predicted 1863
10 SASI_Hs02_00356780 predicted 1567
11 SASI_Hs01_00073694 predicted 1302
12 SASI_Hs01_00073697 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248157 predicted 1326
2 SASI_Rn02_00248158 predicted 547
3 SASI_Rn02_00248159 predicted 1616
4 SASI_Rn02_00248160 predicted 1779
5 SASI_Rn02_00248161 predicted 507
6 SASI_Rn02_00248162 predicted 726
7 SASI_Rn02_00248163 predicted 1506
8 SASI_Rn02_00248164 predicted 674
9 SASI_Rn02_00248165 predicted 572
10 SASI_Rn02_00248166 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069992 predicted 1320
2 SASI_Mm02_00341854 predicted 688
3 SASI_Mm01_00069993 predicted 475
4 SASI_Mm01_00069995 predicted 725
5 SASI_Mm01_00069996 predicted 485
6 SASI_Mm01_00069997 predicted 797
7 SASI_Mm01_00069998 predicted 1626
8 SASI_Mm01_00069999 predicted 665
9 SASI_Mm01_00070000 predicted 997
10 SASI_Mm01_00070001 predicted 274
11 SASI_Mm01_00069994 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024511
HAUS3 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024511.5-1383s21c1
Sequence:CCGGGAACTTCTACAGTTATCATATCTCGAGATATGATAACTGTAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024511.5-2246s21c1
Sequence:CCGGGGTACTTAGTCCTGGTAATTTCTCGAGAAATTACCAGGACTAAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024511.5-624s21c1
Sequence:CCGGCACAAATCTCTGAGGTTAAATCTCGAGATTTAACCTCAGAGATTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1021s1c1
Sequence:CCGGGTAATGAACTTCAGGCTCTTACTCGAGTAAGAGCCTGAAGTTCATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-2157s1c1
Sequence:CCGGCTAAATCATCTCCTCACTGATCTCGAGATCAGTGAGGAGATGATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024511.3-1481s1c1
Sequence:CCGGCTTGACCAGTGAGATTATGAACTCGAGTTCATAATCTCACTGGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-974s1c1
Sequence:CCGGGCTGAAGCAGAGTCAAGGAATCTCGAGATTCCTTGACTCTGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1986s1c1
Sequence:CCGGGTACAAGATCAGTTGGCAGTACTCGAGTACTGCCAACTGATCTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1534s1c1
Sequence:CCGGGAAGTTTACCTGCTGTGGTAACTCGAGTTACCACAGCAGGTAAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024511
HAUS3 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024511.5-1383s21c1
Sequence:CCGGGAACTTCTACAGTTATCATATCTCGAGATATGATAACTGTAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024511.5-2246s21c1
Sequence:CCGGGGTACTTAGTCCTGGTAATTTCTCGAGAAATTACCAGGACTAAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024511.5-624s21c1
Sequence:CCGGCACAAATCTCTGAGGTTAAATCTCGAGATTTAACCTCAGAGATTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1021s1c1
Sequence:CCGGGTAATGAACTTCAGGCTCTTACTCGAGTAAGAGCCTGAAGTTCATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-2157s1c1
Sequence:CCGGCTAAATCATCTCCTCACTGATCTCGAGATCAGTGAGGAGATGATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024511.3-1481s1c1
Sequence:CCGGCTTGACCAGTGAGATTATGAACTCGAGTTCATAATCTCACTGGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-974s1c1
Sequence:CCGGGCTGAAGCAGAGTCAAGGAATCTCGAGATTCCTTGACTCTGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1986s1c1
Sequence:CCGGGTACAAGATCAGTTGGCAGTACTCGAGTACTGCCAACTGATCTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1534s1c1
Sequence:CCGGGAAGTTTACCTGCTGTGGTAACTCGAGTTACCACAGCAGGTAAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024511
HAUS3 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024511.5-1383s21c1
Sequence:CCGGGAACTTCTACAGTTATCATATCTCGAGATATGATAACTGTAGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024511.5-2246s21c1
Sequence:CCGGGGTACTTAGTCCTGGTAATTTCTCGAGAAATTACCAGGACTAAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024511.5-624s21c1
Sequence:CCGGCACAAATCTCTGAGGTTAAATCTCGAGATTTAACCTCAGAGATTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1021s1c1
Sequence:CCGGGTAATGAACTTCAGGCTCTTACTCGAGTAAGAGCCTGAAGTTCATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-2157s1c1
Sequence:CCGGCTAAATCATCTCCTCACTGATCTCGAGATCAGTGAGGAGATGATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024511.3-1481s1c1
Sequence:CCGGCTTGACCAGTGAGATTATGAACTCGAGTTCATAATCTCACTGGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-974s1c1
Sequence:CCGGGCTGAAGCAGAGTCAAGGAATCTCGAGATTCCTTGACTCTGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1986s1c1
Sequence:CCGGGTACAAGATCAGTTGGCAGTACTCGAGTACTGCCAACTGATCTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024511.3-1534s1c1
Sequence:CCGGGAAGTTTACCTGCTGTGGTAACTCGAGTTACCACAGCAGGTAAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146159
VALIDATED
HAUS3 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146159.1-1017s21c1
Sequence:CCGGGAGCATGAAGTCGAGTATAAACTCGAGTTTATACTCGACTTCATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-978s21c1
Sequence:CCGGTGTCCAGAAACAGATCATATACTCGAGTATATGATCTGTTTCTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-522s21c1
Sequence:CCGGACGGAATAAATACCAGTTAATCTCGAGATTAACTGGTATTTATTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-1318s21c1
Sequence:CCGGGAGCTTGTCCAGTTATCATATCTCGAGATATGATAACTGGACAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-209s21c1
Sequence:CCGGGTTATCCCAAAGCTGATATTCCTCGAGGAATATCAGCTTTGGGATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146159
VALIDATED
HAUS3 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146159.1-1017s21c1
Sequence:CCGGGAGCATGAAGTCGAGTATAAACTCGAGTTTATACTCGACTTCATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-978s21c1
Sequence:CCGGTGTCCAGAAACAGATCATATACTCGAGTATATGATCTGTTTCTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-522s21c1
Sequence:CCGGACGGAATAAATACCAGTTAATCTCGAGATTAACTGGTATTTATTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-1318s21c1
Sequence:CCGGGAGCTTGTCCAGTTATCATATCTCGAGATATGATAACTGGACAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-209s21c1
Sequence:CCGGGTTATCCCAAAGCTGATATTCCTCGAGGAATATCAGCTTTGGGATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146159
VALIDATED
HAUS3 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146159.1-1017s21c1
Sequence:CCGGGAGCATGAAGTCGAGTATAAACTCGAGTTTATACTCGACTTCATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-978s21c1
Sequence:CCGGTGTCCAGAAACAGATCATATACTCGAGTATATGATCTGTTTCTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-522s21c1
Sequence:CCGGACGGAATAAATACCAGTTAATCTCGAGATTAACTGGTATTTATTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-1318s21c1
Sequence:CCGGGAGCTTGTCCAGTTATCATATCTCGAGATATGATAACTGGACAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_146159.1-209s21c1
Sequence:CCGGGTTATCCCAAAGCTGATATTCCTCGAGGAATATCAGCTTTGGGATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)