EMAIL THIS PAGE TO A FRIEND

HAUS4

HAUS augmin-like complex, subunit 4

87 Gene Product Result for
Synonyms: C14orf94
Gene ID:
Human(54930) Summary: This gene encodes a subunit of the centrosome complex termed the human augmin complex. The encoded protein localizes to the spindle microtubules and may play a role in mitotic spindle assembly and maintenance of centrosome integrity during cell division. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Mouse(219072) HAUS augmin-like complex, subunit 4
Rat(305882) HAUS augmin-like complex, subunit 4
Zebrafish(436698) HAUS augmin-like complex, subunit 4
dog(480243) HAUS augmin-like complex, subunit 4
cow(614307) HAUS augmin-like complex, subunit 4
Horse(100052680) HAUS augmin-like complex, subunit 4
domestic cat(101091704) HAUS augmin-like complex, subunit 4
domestic guinea pig(100718326) HAUS augmin-like complex, subunit 4
naked mole-rat(101721573) HAUS augmin-like complex, subunit 4
sheep(101102395) HAUS augmin-like complex, subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017815 Rosetta Predictions human pricing
NM_001013995 Rosetta Predictions rat pricing
NM_145462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022834 predicted 1093
2 SASI_Hs01_00022835 predicted 1027
3 SASI_Hs01_00022836 predicted 1208
4 SASI_Hs01_00022837 predicted 1068
5 SASI_Hs01_00022838 predicted 1026
6 SASI_Hs01_00022839 predicted 308
7 SASI_Hs01_00022840 predicted 745
8 SASI_Hs01_00022841 predicted 1087
9 SASI_Hs02_00350680 predicted 546
10 SASI_Hs01_00022842 predicted 1010
11 SASI_Hs01_00022843 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091690 predicted 1030
2 SASI_Rn02_00201353 predicted 982
3 SASI_Rn01_00091694 predicted 508
4 SASI_Rn02_00201354 predicted 1198
5 SASI_Rn01_00091695 predicted 268
6 SASI_Rn01_00091696 predicted 290
7 SASI_Rn01_00091697 predicted 369
8 SASI_Rn01_00091698 predicted 406
9 SASI_Rn01_00091699 predicted 279
10 SASI_Rn02_00201355 predicted 677
11 SASI_Rn01_00091691 predicted 900
12 SASI_Rn01_00091692 predicted 977
13 SASI_Rn01_00091693 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081786 predicted 1153
2 SASI_Mm02_00340858 predicted 992
3 SASI_Mm01_00081787 predicted 383
4 SASI_Mm02_00340859 predicted 278
5 SASI_Mm01_00081788 predicted 1133
6 SASI_Mm01_00081789 predicted 379
7 SASI_Mm01_00081790 predicted 999
8 SASI_Mm01_00081791 predicted 983
9 SASI_Mm01_00081792 predicted 277
10 SASI_Mm01_00081793 predicted 420
11 SASI_Mm01_00081794 predicted 968
12 SASI_Mm01_00081795 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017815
VALIDATED
HAUS4 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-479s21c1
Sequence:CCGGAGTTGCTTGTGGACTACTATGCTCGAGCATAGTAGTCCACAAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-1024s21c1
Sequence:CCGGTGCGGTGCTATGATCCTTAAGCTCGAGCTTAAGGATCATAGCACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017815.1-1345s1c1
Sequence:CCGGCCTCCTAATCTTCCTGCTAGTCTCGAGACTAGCAGGAAGATTAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-1409s21c1
Sequence:CCGGGGAAATGCTTACGCTTGAAACCTCGAGGTTTCAAGCGTAAGCATTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-963s21c1
Sequence:CCGGACACCGGCTGAAGACTCAATCCTCGAGGATTGAGTCTTCAGCCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017815.1-1097s21c1
Sequence:CCGGTGGAAGTTCATCGTCTGATTACTCGAGTAATCAGACGATGAACTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017815
VALIDATED
HAUS4 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-479s21c1
Sequence:CCGGAGTTGCTTGTGGACTACTATGCTCGAGCATAGTAGTCCACAAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-1024s21c1
Sequence:CCGGTGCGGTGCTATGATCCTTAAGCTCGAGCTTAAGGATCATAGCACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017815.1-1345s1c1
Sequence:CCGGCCTCCTAATCTTCCTGCTAGTCTCGAGACTAGCAGGAAGATTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-1409s21c1
Sequence:CCGGGGAAATGCTTACGCTTGAAACCTCGAGGTTTCAAGCGTAAGCATTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-963s21c1
Sequence:CCGGACACCGGCTGAAGACTCAATCCTCGAGGATTGAGTCTTCAGCCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017815.1-1097s21c1
Sequence:CCGGTGGAAGTTCATCGTCTGATTACTCGAGTAATCAGACGATGAACTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017815
VALIDATED
HAUS4 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-479s21c1
Sequence:CCGGAGTTGCTTGTGGACTACTATGCTCGAGCATAGTAGTCCACAAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-1024s21c1
Sequence:CCGGTGCGGTGCTATGATCCTTAAGCTCGAGCTTAAGGATCATAGCACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017815.1-1345s1c1
Sequence:CCGGCCTCCTAATCTTCCTGCTAGTCTCGAGACTAGCAGGAAGATTAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-1409s21c1
Sequence:CCGGGGAAATGCTTACGCTTGAAACCTCGAGGTTTCAAGCGTAAGCATTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017815.1-963s21c1
Sequence:CCGGACACCGGCTGAAGACTCAATCCTCGAGGATTGAGTCTTCAGCCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017815.1-1097s21c1
Sequence:CCGGTGGAAGTTCATCGTCTGATTACTCGAGTAATCAGACGATGAACTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145462
HAUS4 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-450s21c1
Sequence:CCGGAGCTGCTCGTGGACTACTATGCTCGAGCATAGTAGTCCACGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-643s1c1
Sequence:CCGGCCAGGATTTCGTGTGGATGAACTCGAGTTCATCCACACGAAATCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-996s1c1
Sequence:CCGGGCAGTGCTATGATTCTTAGGTCTCGAGACCTAAGAATCATAGCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-1175s1c1
Sequence:CCGGGAAGACTTTGAGAGCTTGGTACTCGAGTACCAAGCTCTCAAAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-226s21c1
Sequence:CCGGGCTGCTGCAAGTGTGCGTTAACTCGAGTTAACGCACACTTGCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-267s21c1
Sequence:CCGGTGACGGAAGAGGATCTCATACCTCGAGGTATGAGATCCTCTTCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-1054s21c1
Sequence:CCGGCAACGCTGAGAAAGTGGAAATCTCGAGATTTCCACTTTCTCAGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-1054s1c1
Sequence:CCGGCAACGCTGAGAAAGTGGAAATCTCGAGATTTCCACTTTCTCAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145462.1-1465s1c1
Sequence:CCGGGGAAATGTAGCTATCAGATTTCTCGAGAAATCTGATAGCTACATTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145462
HAUS4 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-450s21c1
Sequence:CCGGAGCTGCTCGTGGACTACTATGCTCGAGCATAGTAGTCCACGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-643s1c1
Sequence:CCGGCCAGGATTTCGTGTGGATGAACTCGAGTTCATCCACACGAAATCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-996s1c1
Sequence:CCGGGCAGTGCTATGATTCTTAGGTCTCGAGACCTAAGAATCATAGCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-1175s1c1
Sequence:CCGGGAAGACTTTGAGAGCTTGGTACTCGAGTACCAAGCTCTCAAAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-226s21c1
Sequence:CCGGGCTGCTGCAAGTGTGCGTTAACTCGAGTTAACGCACACTTGCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-267s21c1
Sequence:CCGGTGACGGAAGAGGATCTCATACCTCGAGGTATGAGATCCTCTTCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-1054s21c1
Sequence:CCGGCAACGCTGAGAAAGTGGAAATCTCGAGATTTCCACTTTCTCAGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-1054s1c1
Sequence:CCGGCAACGCTGAGAAAGTGGAAATCTCGAGATTTCCACTTTCTCAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145462.1-1465s1c1
Sequence:CCGGGGAAATGTAGCTATCAGATTTCTCGAGAAATCTGATAGCTACATTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145462
HAUS4 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-450s21c1
Sequence:CCGGAGCTGCTCGTGGACTACTATGCTCGAGCATAGTAGTCCACGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-643s1c1
Sequence:CCGGCCAGGATTTCGTGTGGATGAACTCGAGTTCATCCACACGAAATCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-996s1c1
Sequence:CCGGGCAGTGCTATGATTCTTAGGTCTCGAGACCTAAGAATCATAGCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-1175s1c1
Sequence:CCGGGAAGACTTTGAGAGCTTGGTACTCGAGTACCAAGCTCTCAAAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-226s21c1
Sequence:CCGGGCTGCTGCAAGTGTGCGTTAACTCGAGTTAACGCACACTTGCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-267s21c1
Sequence:CCGGTGACGGAAGAGGATCTCATACCTCGAGGTATGAGATCCTCTTCCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145462.1-1054s21c1
Sequence:CCGGCAACGCTGAGAAAGTGGAAATCTCGAGATTTCCACTTTCTCAGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145462.1-1054s1c1
Sequence:CCGGCAACGCTGAGAAAGTGGAAATCTCGAGATTTCCACTTTCTCAGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145462.1-1465s1c1
Sequence:CCGGGGAAATGTAGCTATCAGATTTCTCGAGAAATCTGATAGCTACATTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)