EMAIL THIS PAGE TO A FRIEND

HAUS5

HAUS augmin-like complex, subunit 5

140 Gene Product Result for
Synonyms: KIAA0841 dgt5
UniProtKB ID: O94927, B2RXK1, Q6P2P7, Q7L3D5, Q96CT8
Gene ID:
Human(23354) Summary: HAUS5 is 1 of 8 subunits of the 390-kD human augmin complex, or HAUS complex. The augmin complex was first identified in Drosophila, and its name comes from the Latin verb 'augmentare,' meaning 'to increase.' The augmin complex is a microtubule-binding complex involved in microtubule generation within the mitotic spindle and is vital to mitotic spindle assembly (Goshima et al., 2008 [PubMed 18443220]
Mouse(71909) HAUS augmin-like complex, subunit 5
Rat(100362495) HAUS augmin-like complex, subunit 5
Zebrafish(492797) HAUS augmin-like complex, subunit 5
cow(510660) HAUS augmin-like complex, subunit 5
domestic cat(101099261) HAUS augmin-like complex, subunit 5
dog(476481) HAUS augmin-like complex, subunit 5
sheep(101116420) HAUS augmin-like complex, subunit 5
Domestic Rabbit(100352463) HAUS augmin-like complex, subunit 5
domestic guinea pig(100723436) HAUS augmin-like complex, subunit 5
naked mole-rat(101722946) HAUS augmin-like complex, subunit 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027999 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027999 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027999 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015302 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015302 Rosetta Predictions human pricing
XM_049237 Rosetta Predictions human pricing
XM_932172 Rosetta Predictions human pricing
XM_932173 Rosetta Predictions human pricing
XM_932178 Rosetta Predictions human pricing
XM_932182 Rosetta Predictions human pricing
XM_932185 Rosetta Predictions human pricing
XM_932189 Rosetta Predictions human pricing
XM_932191 Rosetta Predictions human pricing
XM_932194 Rosetta Predictions human pricing
XM_001001304 Rosetta Predictions mouse pricing
XM_355883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347509 predicted 519
2 SASI_Hs02_00347510 predicted 194
3 SASI_Hs02_00347511 predicted 539
4 SASI_Hs02_00347512 predicted 391
5 SASI_Hs02_00347513 predicted 1051
6 SASI_Hs02_00347514 predicted 1325
7 SASI_Hs02_00347515 predicted 260
8 SASI_Hs02_00347516 predicted 1598
9 SASI_Hs02_00347517 predicted 546
10 SASI_Hs02_00347518 predicted 1782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_049237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258130 predicted 1944
2 SASI_Hs01_00258131 predicted 516
3 SASI_Hs01_00258132 predicted 534
4 SASI_Hs01_00258133 predicted 389
5 SASI_Hs01_00258134 predicted 255
6 SASI_Hs01_00258135 predicted 544
7 SASI_Hs01_00258136 predicted 1776
8 SASI_Hs01_00258137 predicted 1781
9 SASI_Hs01_00258138 predicted 530
10 SASI_Hs01_00258139 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285270 predicted 625
2 SASI_Hs01_00285271 predicted 524
3 SASI_Hs01_00285272 predicted 463
4 SASI_Hs01_00285273 predicted 466
5 SASI_Hs01_00285274 predicted 613
6 SASI_Hs01_00285275 predicted 620
7 SASI_Hs01_00285276 predicted 525
8 SASI_Hs01_00285277 predicted 620
9 SASI_Hs01_00285278 predicted 466
10 SASI_Hs01_00285279 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282862 predicted 605
2 SASI_Hs01_00282863 predicted 2014
3 SASI_Hs01_00282864 predicted 601
4 SASI_Hs01_00282865 predicted 558
5 SASI_Hs01_00282866 predicted 614
6 SASI_Hs01_00282867 predicted 629
7 SASI_Hs01_00282868 predicted 1861
8 SASI_Hs01_00282869 predicted 1864
9 SASI_Hs01_00282870 predicted 615
10 SASI_Hs01_00282871 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00301073 predicted 651
2 SASI_Hs01_00301074 predicted 370
3 SASI_Hs01_00301075 predicted 468
4 SASI_Hs01_00301076 predicted 394
5 SASI_Hs01_00301077 predicted 435
6 SASI_Hs01_00301078 predicted 431
7 SASI_Hs01_00301079 predicted 435
8 SASI_Hs01_00301080 predicted 653
9 SASI_Hs01_00301081 predicted 375
10 SASI_Hs01_00301082 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293123 predicted 381
2 SASI_Hs01_00293124 predicted 373
3 SASI_Hs01_00293125 predicted 244
4 SASI_Hs01_00293126 predicted 447
5 SASI_Hs01_00293127 predicted 246
6 SASI_Hs01_00293128 predicted 268
7 SASI_Hs01_00293129 predicted 408
8 SASI_Hs01_00293130 predicted 448
9 SASI_Hs01_00293131 predicted 369
10 SASI_Hs01_00293132 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299583 predicted 811
2 SASI_Hs01_00299584 predicted 519
3 SASI_Hs01_00299585 predicted 541
4 SASI_Hs01_00299586 predicted 390
5 SASI_Hs01_00299587 predicted 993
6 SASI_Hs01_00299588 predicted 1252
7 SASI_Hs01_00299589 predicted 542
8 SASI_Hs01_00299590 predicted 1027
9 SASI_Hs01_00299591 predicted 264
10 SASI_Hs01_00299592 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282309 predicted 675
2 SASI_Hs01_00282310 predicted 674
3 SASI_Hs01_00282311 predicted 179
4 SASI_Hs01_00282312 predicted 689
5 SASI_Hs01_00282313 predicted 538
6 SASI_Hs01_00282314 predicted 467
7 SASI_Hs01_00282315 predicted 149
8 SASI_Hs01_00282316 predicted 63
9 SASI_Hs01_00282317 predicted 697
10 SASI_Hs01_00282318 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251749 predicted 276
2 SASI_Hs01_00251750 predicted 325
3 SASI_Hs01_00251751 predicted 362
4 SASI_Hs01_00251752 predicted 318
5 SASI_Hs01_00251753 predicted 357
6 SASI_Hs01_00251754 predicted 326
7 SASI_Hs01_00251755 predicted 377
8 SASI_Hs01_00251756 predicted 302
9 SASI_Hs01_00251757 predicted 360
10 SASI_Hs01_00251758 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261107 predicted 556
2 SASI_Hs01_00261108 predicted 1979
3 SASI_Hs01_00261109 predicted 555
4 SASI_Hs01_00261110 predicted 569
5 SASI_Hs01_00261111 predicted 419
6 SASI_Hs01_00261112 predicted 583
7 SASI_Hs01_00261113 predicted 1810
8 SASI_Hs01_00261114 predicted 1819
9 SASI_Hs01_00261115 predicted 564
10 SASI_Hs01_00261116 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00355064 predicted 534
2 SASI_Mm02_00355065 predicted 1521
3 SASI_Mm02_00355066 predicted 197
4 SASI_Mm02_00355067 predicted 246
5 SASI_Mm02_00355068 predicted 358
6 SASI_Mm02_00355069 predicted 1344
7 SASI_Mm02_00355070 predicted 1597
8 SASI_Mm02_00355071 predicted 1649
9 SASI_Mm02_00355072 predicted 1370
10 SASI_Mm02_00355073 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425869 predicted 1462
2 SASI_Mm02_00425870 predicted 1516
3 SASI_Mm01_00208597 predicted 1526
4 SASI_Mm01_00208599 predicted 250
5 SASI_Mm01_00208602 predicted 1601
6 SASI_Mm02_00425871 predicted 1257
7 SASI_Mm01_00208604 predicted 1368
8 SASI_Mm02_00425872 predicted 1575
9 SASI_Mm02_00425873 predicted 1300
10 SASI_Mm02_00425874 predicted 228
11 SASI_Mm01_00208596 predicted 561
12 SASI_Mm01_00208598 predicted 223
13 SASI_Mm01_00208600 predicted 380
14 SASI_Mm01_00208601 predicted 1363
15 SASI_Mm01_00208603 predicted 1671
16 SASI_Mm01_00208605 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027999
VALIDATED
HAUS5 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-640s21c1
Sequence:CCGGTGCACCCTCCGAACTCAATTCCTCGAGGAATTGAGTTCGGAGGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1101s21c1
Sequence:CCGGGCTTAGGCACAGTGGTCTACTCTCGAGAGTAGACCACTGTGCCTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027999.1-185s21c1
Sequence:CCGGCTGACATCTGGGCCTACATTGCTCGAGCAATGTAGGCCCAGATGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1467s21c1
Sequence:CCGGCAAAGGGCTGAAGCCGTTATCCTCGAGGATAACGGCTTCAGCCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1982s21c1
Sequence:CCGGAGAGTCAAGACTTGCAATTTACTCGAGTAAATTGCAAGTCTTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027999
VALIDATED
HAUS5 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-640s21c1
Sequence:CCGGTGCACCCTCCGAACTCAATTCCTCGAGGAATTGAGTTCGGAGGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1101s21c1
Sequence:CCGGGCTTAGGCACAGTGGTCTACTCTCGAGAGTAGACCACTGTGCCTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027999.1-185s21c1
Sequence:CCGGCTGACATCTGGGCCTACATTGCTCGAGCAATGTAGGCCCAGATGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1467s21c1
Sequence:CCGGCAAAGGGCTGAAGCCGTTATCCTCGAGGATAACGGCTTCAGCCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1982s21c1
Sequence:CCGGAGAGTCAAGACTTGCAATTTACTCGAGTAAATTGCAAGTCTTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027999
VALIDATED
HAUS5 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-640s21c1
Sequence:CCGGTGCACCCTCCGAACTCAATTCCTCGAGGAATTGAGTTCGGAGGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1101s21c1
Sequence:CCGGGCTTAGGCACAGTGGTCTACTCTCGAGAGTAGACCACTGTGCCTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027999.1-185s21c1
Sequence:CCGGCTGACATCTGGGCCTACATTGCTCGAGCAATGTAGGCCCAGATGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1467s21c1
Sequence:CCGGCAAAGGGCTGAAGCCGTTATCCTCGAGGATAACGGCTTCAGCCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346727    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027999.1-1982s21c1
Sequence:CCGGAGAGTCAAGACTTGCAATTTACTCGAGTAAATTGCAAGTCTTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015302
HAUS5 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 5
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000263339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015302.1-2859s21c1
Sequence:CCGGCTGCGTGGGTTACTCAATTTACTCGAGTAAATTGAGTAACCCACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-703s21c1
Sequence:CCGGGACCACTTTGGCACTTCGTACCTCGAGGTACGAAGTGCCAAAGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-267s21c1
Sequence:CCGGACAGGTCCGTCGGAAGTTAGACTCGAGTCTAACTTCCGACGGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-170s21c1
Sequence:CCGGCTGACATCTGGGCCTACATCTCTCGAGAGATGTAGGCCCAGATGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015302
HAUS5 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 5
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000263339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015302.1-2859s21c1
Sequence:CCGGCTGCGTGGGTTACTCAATTTACTCGAGTAAATTGAGTAACCCACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-703s21c1
Sequence:CCGGGACCACTTTGGCACTTCGTACCTCGAGGTACGAAGTGCCAAAGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-267s21c1
Sequence:CCGGACAGGTCCGTCGGAAGTTAGACTCGAGTCTAACTTCCGACGGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-170s21c1
Sequence:CCGGCTGACATCTGGGCCTACATCTCTCGAGAGATGTAGGCCCAGATGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015302
HAUS5 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 5
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000263339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015302.1-2859s21c1
Sequence:CCGGCTGCGTGGGTTACTCAATTTACTCGAGTAAATTGAGTAACCCACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-703s21c1
Sequence:CCGGGACCACTTTGGCACTTCGTACCTCGAGGTACGAAGTGCCAAAGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-267s21c1
Sequence:CCGGACAGGTCCGTCGGAAGTTAGACTCGAGTCTAACTTCCGACGGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015302.1-170s21c1
Sequence:CCGGCTGACATCTGGGCCTACATCTCTCGAGAGATGTAGGCCCAGATGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)