EMAIL THIS PAGE TO A FRIEND

HAUS6

HAUS augmin-like complex, subunit 6

123 Gene Product Result for
Synonyms: Dgt6 FAM29A
Gene ID:
Human(54801) Summary: The protein encoded by this gene is a subunit of the augmin complex. The augmin complex plays a role in microtubule attachment to the kinetochore and central spindle formation. This protein may have a role in efficient chromosome congression and segregation by promoting microtubule-dependent microtubule amplification. Pseudogenes of this gene are located on chromosomes 7 and 20. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Mouse(230376) HAUS augmin-like complex, subunit 6
domestic guinea pig(100712750) HAUS augmin-like complex, subunit 6
naked mole-rat(101721179) HAUS augmin-like complex, subunit 6
sheep(101123274) HAUS augmin-like complex, subunit 6
Domestic Rabbit(100344700) HAUS augmin-like complex, subunit 6
Zebrafish(558814) HAUS augmin-like complex, subunit 6
cow(538833) HAUS augmin-like complex, subunit 6
domestic cat(101082785) HAUS augmin-like complex, subunit 6
dog(481551) HAUS augmin-like complex, subunit 6
chicken(427238) HAUS augmin-like complex, subunit 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017645 Rosetta Predictions human pricing
NM_173400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105872 predicted 755
2 SASI_Hs01_00105873 predicted 1941
3 SASI_Hs01_00105874 predicted 3141
4 SASI_Hs01_00105875 predicted 3151
5 SASI_Hs01_00105876 predicted 1461
6 SASI_Hs02_00350344 predicted 1049
7 SASI_Hs01_00105878 predicted 911
8 SASI_Hs01_00105879 predicted 1851
9 SASI_Hs01_00105880 predicted 2793
10 SASI_Hs01_00105881 predicted 1583
11 SASI_Hs01_00105877 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085551 predicted 2928
2 SASI_Mm02_00345256 predicted 2228
3 SASI_Mm01_00085553 predicted 2158
4 SASI_Mm01_00085554 predicted 507
5 SASI_Mm01_00085555 predicted 425
6 SASI_Mm01_00085556 predicted 1237
7 SASI_Mm01_00085557 predicted 789
8 SASI_Mm02_00345257 predicted 2439
9 SASI_Mm01_00085558 predicted 2778
10 SASI_Mm01_00085559 predicted 2413
11 SASI_Mm01_00085552 predicted 1014
12 SASI_Mm01_00085560 predicted 2352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017645
VALIDATED
HAUS6 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017645.3-2910s21c1
Sequence:CCGGATTTGCATACTGAGCATATAACTCGAGTTATATGCTCAGTATGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-2116s21c1
Sequence:CCGGGCCAGAATCATTACCTGTGTTCTCGAGAACACAGGTAATGATTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017645.3-4768s1c1
Sequence:CCGGGCAGGTACGTTGTTGCATATACTCGAGTATATGCAACAACGTACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2116s1c1
Sequence:CCGGGCCAGAATCATTACCTGTGTTCTCGAGAACACAGGTAATGATTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-3387s21c1
Sequence:CCGGGAGTAATCTTGTAAGCATTAACTCGAGTTAATGCTTACAAGATTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017645.3-2967s21c1
Sequence:CCGGGGTCTCTTTCACCACTAATTACTCGAGTAATTAGTGGTGAAAGAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017645.3-1235s1c1
Sequence:CCGGGCAAGATTGACGGTAGACCTTCTCGAGAAGGTCTACCGTCAATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2365s1c1
Sequence:CCGGGCTTTCAGAAACTAGCCGAATCTCGAGATTCGGCTAGTTTCTGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-2365s21c1
Sequence:CCGGGCTTTCAGAAACTAGCCGAATCTCGAGATTCGGCTAGTTTCTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2081s1c1
Sequence:CCGGCCAATTCAAATGGATGCTGAACTCGAGTTCAGCATCCATTTGAATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-1550s1c1
Sequence:CCGGGCACATAAGCAACATAACCAACTCGAGTTGGTTATGTTGCTTATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017645
VALIDATED
HAUS6 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017645.3-2910s21c1
Sequence:CCGGATTTGCATACTGAGCATATAACTCGAGTTATATGCTCAGTATGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-2116s21c1
Sequence:CCGGGCCAGAATCATTACCTGTGTTCTCGAGAACACAGGTAATGATTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017645.3-4768s1c1
Sequence:CCGGGCAGGTACGTTGTTGCATATACTCGAGTATATGCAACAACGTACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2116s1c1
Sequence:CCGGGCCAGAATCATTACCTGTGTTCTCGAGAACACAGGTAATGATTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-3387s21c1
Sequence:CCGGGAGTAATCTTGTAAGCATTAACTCGAGTTAATGCTTACAAGATTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017645.3-2967s21c1
Sequence:CCGGGGTCTCTTTCACCACTAATTACTCGAGTAATTAGTGGTGAAAGAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017645.3-1235s1c1
Sequence:CCGGGCAAGATTGACGGTAGACCTTCTCGAGAAGGTCTACCGTCAATCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2365s1c1
Sequence:CCGGGCTTTCAGAAACTAGCCGAATCTCGAGATTCGGCTAGTTTCTGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-2365s21c1
Sequence:CCGGGCTTTCAGAAACTAGCCGAATCTCGAGATTCGGCTAGTTTCTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2081s1c1
Sequence:CCGGCCAATTCAAATGGATGCTGAACTCGAGTTCAGCATCCATTTGAATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-1550s1c1
Sequence:CCGGGCACATAAGCAACATAACCAACTCGAGTTGGTTATGTTGCTTATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017645
VALIDATED
HAUS6 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017645.3-2910s21c1
Sequence:CCGGATTTGCATACTGAGCATATAACTCGAGTTATATGCTCAGTATGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-2116s21c1
Sequence:CCGGGCCAGAATCATTACCTGTGTTCTCGAGAACACAGGTAATGATTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017645.3-4768s1c1
Sequence:CCGGGCAGGTACGTTGTTGCATATACTCGAGTATATGCAACAACGTACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2116s1c1
Sequence:CCGGGCCAGAATCATTACCTGTGTTCTCGAGAACACAGGTAATGATTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-3387s21c1
Sequence:CCGGGAGTAATCTTGTAAGCATTAACTCGAGTTAATGCTTACAAGATTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017645.3-2967s21c1
Sequence:CCGGGGTCTCTTTCACCACTAATTACTCGAGTAATTAGTGGTGAAAGAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017645.3-1235s1c1
Sequence:CCGGGCAAGATTGACGGTAGACCTTCTCGAGAAGGTCTACCGTCAATCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2365s1c1
Sequence:CCGGGCTTTCAGAAACTAGCCGAATCTCGAGATTCGGCTAGTTTCTGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017645.3-2365s21c1
Sequence:CCGGGCTTTCAGAAACTAGCCGAATCTCGAGATTCGGCTAGTTTCTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-2081s1c1
Sequence:CCGGCCAATTCAAATGGATGCTGAACTCGAGTTCAGCATCCATTTGAATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017645.3-1550s1c1
Sequence:CCGGGCACATAAGCAACATAACCAACTCGAGTTGGTTATGTTGCTTATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173400
VALIDATED
HAUS6 MISSION shRNA Bacterial Glycerol Stock
HAUS augmin-like complex, subunit 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173400.2-2515s1c1
Sequence:CCGGGCCTAAGTCTTAATAGTTCTACTCGAGTAGAACTATTAAGACTTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173400.2-1956s1c1
Sequence:CCGGCCAGAGAACTTGATAACTGATCTCGAGATCAGTTATCAAGTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-1363s21c1
Sequence:CCGGTGTCTCCTTTCAGACTAATTACTCGAGTAATTAGTCTGAAAGGAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173400.2-3435s21c1
Sequence:CCGGTTTACCTTTGGATGGATATTTCTCGAGAAATATCCATCCAAAGGTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-2468s21c1
Sequence:CCGGGTTGAGTGGTATTGGTATATTCTCGAGAATATACCAATACCACTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-482s21c1
Sequence:CCGGACATTGCTGTGAATGGTTAAACTCGAGTTTAACCATTCACAGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-604s21c1
Sequence:CCGGCAAGATATGTTGCAATCAAATCTCGAGATTTGATTGCAACATATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173400
VALIDATED
HAUS6 MISSION shRNA shRNA Plasmid DNA
HAUS augmin-like complex, subunit 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173400.2-2515s1c1
Sequence:CCGGGCCTAAGTCTTAATAGTTCTACTCGAGTAGAACTATTAAGACTTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173400.2-1956s1c1
Sequence:CCGGCCAGAGAACTTGATAACTGATCTCGAGATCAGTTATCAAGTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-1363s21c1
Sequence:CCGGTGTCTCCTTTCAGACTAATTACTCGAGTAATTAGTCTGAAAGGAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173400.2-3435s21c1
Sequence:CCGGTTTACCTTTGGATGGATATTTCTCGAGAAATATCCATCCAAAGGTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-2468s21c1
Sequence:CCGGGTTGAGTGGTATTGGTATATTCTCGAGAATATACCAATACCACTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-482s21c1
Sequence:CCGGACATTGCTGTGAATGGTTAAACTCGAGTTTAACCATTCACAGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-604s21c1
Sequence:CCGGCAAGATATGTTGCAATCAAATCTCGAGATTTGATTGCAACATATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173400
VALIDATED
HAUS6 MISSION shRNA Lentiviral Transduction Particles
HAUS augmin-like complex, subunit 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173400.2-2515s1c1
Sequence:CCGGGCCTAAGTCTTAATAGTTCTACTCGAGTAGAACTATTAAGACTTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173400.2-1956s1c1
Sequence:CCGGCCAGAGAACTTGATAACTGATCTCGAGATCAGTTATCAAGTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-1363s21c1
Sequence:CCGGTGTCTCCTTTCAGACTAATTACTCGAGTAATTAGTCTGAAAGGAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173400.2-3435s21c1
Sequence:CCGGTTTACCTTTGGATGGATATTTCTCGAGAAATATCCATCCAAAGGTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-2468s21c1
Sequence:CCGGGTTGAGTGGTATTGGTATATTCTCGAGAATATACCAATACCACTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-482s21c1
Sequence:CCGGACATTGCTGTGAATGGTTAAACTCGAGTTTAACCATTCACAGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173400.2-604s21c1
Sequence:CCGGCAAGATATGTTGCAATCAAATCTCGAGATTTGATTGCAACATATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)